FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632574_at:

>probe:Drosophila_2:1632574_at:254:401; Interrogation_Position=1015; Antisense; GACATCTACTGGTCGTATGCGGGCT
>probe:Drosophila_2:1632574_at:498:667; Interrogation_Position=1060; Antisense; TACGGCTTTACCATCACGGTGGCGA
>probe:Drosophila_2:1632574_at:218:639; Interrogation_Position=1121; Antisense; TCGGCCTTGTCTTTGGTGTGAACAC
>probe:Drosophila_2:1632574_at:278:259; Interrogation_Position=1191; Antisense; CACGGACACTGGTTTTGAGCTCGAT
>probe:Drosophila_2:1632574_at:641:489; Interrogation_Position=1227; Antisense; GTACACGGCGTATGCATTCTATTTT
>probe:Drosophila_2:1632574_at:249:11; Interrogation_Position=1242; Antisense; ATTCTATTTTATTGGCGTCGGCGTC
>probe:Drosophila_2:1632574_at:267:327; Interrogation_Position=1256; Antisense; GCGTCGGCGTCTTGTATCTGATATC
>probe:Drosophila_2:1632574_at:16:63; Interrogation_Position=1300; Antisense; ATGTGCCGCAACAACGACGTCGAAA
>probe:Drosophila_2:1632574_at:53:275; Interrogation_Position=768; Antisense; CATTGGACTGGCTGGTTACCTGCAG
>probe:Drosophila_2:1632574_at:398:77; Interrogation_Position=791; Antisense; AGGTCACTTACTACGTTCAGGTTCT
>probe:Drosophila_2:1632574_at:495:201; Interrogation_Position=830; Antisense; AACCGGAGCCTGTTATTGCGTGGAA
>probe:Drosophila_2:1632574_at:722:275; Interrogation_Position=890; Antisense; CTCTAAGTGCTTTGGCCGCTGGTTA
>probe:Drosophila_2:1632574_at:213:475; Interrogation_Position=911; Antisense; GTTATCTGCACACCGGAAGGCTCAG
>probe:Drosophila_2:1632574_at:661:63; Interrogation_Position=987; Antisense; ATGTGTGCTGATCTGTTGCTGGACA

Paste this into a BLAST search page for me
GACATCTACTGGTCGTATGCGGGCTTACGGCTTTACCATCACGGTGGCGATCGGCCTTGTCTTTGGTGTGAACACCACGGACACTGGTTTTGAGCTCGATGTACACGGCGTATGCATTCTATTTTATTCTATTTTATTGGCGTCGGCGTCGCGTCGGCGTCTTGTATCTGATATCATGTGCCGCAACAACGACGTCGAAACATTGGACTGGCTGGTTACCTGCAGAGGTCACTTACTACGTTCAGGTTCTAACCGGAGCCTGTTATTGCGTGGAACTCTAAGTGCTTTGGCCGCTGGTTAGTTATCTGCACACCGGAAGGCTCAGATGTGTGCTGATCTGTTGCTGGACA

Full Affymetrix probeset data:

Annotations for 1632574_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720