FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632575_at:

>probe:Drosophila_2:1632575_at:263:133; Interrogation_Position=120; Antisense; ACCCCAAGTTGTGGTGGTGCAGCAG
>probe:Drosophila_2:1632575_at:314:133; Interrogation_Position=156; Antisense; ACCGCCACCAGTCATGGTGGTGCAA
>probe:Drosophila_2:1632575_at:648:257; Interrogation_Position=161; Antisense; CACCAGTCATGGTGGTGCAACAGGC
>probe:Drosophila_2:1632575_at:620:309; Interrogation_Position=192; Antisense; GCCACCGTACTACCAAAATCCACCA
>probe:Drosophila_2:1632575_at:313:127; Interrogation_Position=238; Antisense; AGCCACTACCACAATCCACAGTATT
>probe:Drosophila_2:1632575_at:253:309; Interrogation_Position=240; Antisense; CCACTACCACAATCCACAGTATTGA
>probe:Drosophila_2:1632575_at:108:647; Interrogation_Position=33; Antisense; TCATTGCGGCGGACCGCCTCATCGT
>probe:Drosophila_2:1632575_at:444:277; Interrogation_Position=39; Antisense; CGGCGGACCGCCTCATCGTCGTGGA
>probe:Drosophila_2:1632575_at:580:647; Interrogation_Position=51; Antisense; TCATCGTCGTGGACCCGTGATTAAG
>probe:Drosophila_2:1632575_at:162:271; Interrogation_Position=52; Antisense; CATCGTCGTGGACCCGTGATTAAGG
>probe:Drosophila_2:1632575_at:686:411; Interrogation_Position=56; Antisense; GTCGTGGACCCGTGATTAAGGTACA
>probe:Drosophila_2:1632575_at:117:511; Interrogation_Position=59; Antisense; GTGGACCCGTGATTAAGGTACAGAT
>probe:Drosophila_2:1632575_at:25:411; Interrogation_Position=62; Antisense; GACCCGTGATTAAGGTACAGATTGC
>probe:Drosophila_2:1632575_at:506:13; Interrogation_Position=70; Antisense; ATTAAGGTACAGATTGCACCACCAT

Paste this into a BLAST search page for me
ACCCCAAGTTGTGGTGGTGCAGCAGACCGCCACCAGTCATGGTGGTGCAACACCAGTCATGGTGGTGCAACAGGCGCCACCGTACTACCAAAATCCACCAAGCCACTACCACAATCCACAGTATTCCACTACCACAATCCACAGTATTGATCATTGCGGCGGACCGCCTCATCGTCGGCGGACCGCCTCATCGTCGTGGATCATCGTCGTGGACCCGTGATTAAGCATCGTCGTGGACCCGTGATTAAGGGTCGTGGACCCGTGATTAAGGTACAGTGGACCCGTGATTAAGGTACAGATGACCCGTGATTAAGGTACAGATTGCATTAAGGTACAGATTGCACCACCAT

Full Affymetrix probeset data:

Annotations for 1632575_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720