FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632576_at:

>probe:Drosophila_2:1632576_at:350:169; Interrogation_Position=1011; Antisense; AAAGGCCACGATCTGCGATAAGCTG
>probe:Drosophila_2:1632576_at:274:207; Interrogation_Position=1030; Antisense; AAGCTGGGCGAATGCTGCTTTCGAC
>probe:Drosophila_2:1632576_at:8:143; Interrogation_Position=1061; Antisense; ACGGCGGCTCCGAGTATCTGCAGAT
>probe:Drosophila_2:1632576_at:15:97; Interrogation_Position=1082; Antisense; AGATCATGGACCTTGGCTGCTGCAT
>probe:Drosophila_2:1632576_at:500:573; Interrogation_Position=1096; Antisense; GGCTGCTGCATCATCTTAGCTTTAA
>probe:Drosophila_2:1632576_at:82:709; Interrogation_Position=1117; Antisense; TTAAAGTAATCTCATCCCACTCAGC
>probe:Drosophila_2:1632576_at:671:707; Interrogation_Position=1149; Antisense; TTACATGTACTTTATCCGCGACTGG
>probe:Drosophila_2:1632576_at:74:329; Interrogation_Position=612; Antisense; GCGTTGCTCTAAATTTCGCTTCAAG
>probe:Drosophila_2:1632576_at:689:307; Interrogation_Position=722; Antisense; CCATTGTCAAAATTTCCGGCGGAGA
>probe:Drosophila_2:1632576_at:276:707; Interrogation_Position=788; Antisense; TTAAAGGGCCCGAGCACATCATCAA
>probe:Drosophila_2:1632576_at:275:451; Interrogation_Position=820; Antisense; GATCTGTTCGAGATGTCGGGCGTTA
>probe:Drosophila_2:1632576_at:93:79; Interrogation_Position=875; Antisense; AGGTCTGTCGCTCTGGGAACTACGA
>probe:Drosophila_2:1632576_at:76:267; Interrogation_Position=910; Antisense; CAGTTCGTGCGGGAGATTGGCTTCT
>probe:Drosophila_2:1632576_at:502:93; Interrogation_Position=965; Antisense; AGTTCGTCGAGTTCATTGTCCATCA

Paste this into a BLAST search page for me
AAAGGCCACGATCTGCGATAAGCTGAAGCTGGGCGAATGCTGCTTTCGACACGGCGGCTCCGAGTATCTGCAGATAGATCATGGACCTTGGCTGCTGCATGGCTGCTGCATCATCTTAGCTTTAATTAAAGTAATCTCATCCCACTCAGCTTACATGTACTTTATCCGCGACTGGGCGTTGCTCTAAATTTCGCTTCAAGCCATTGTCAAAATTTCCGGCGGAGATTAAAGGGCCCGAGCACATCATCAAGATCTGTTCGAGATGTCGGGCGTTAAGGTCTGTCGCTCTGGGAACTACGACAGTTCGTGCGGGAGATTGGCTTCTAGTTCGTCGAGTTCATTGTCCATCA

Full Affymetrix probeset data:

Annotations for 1632576_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720