FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632581_at:

>probe:Drosophila_2:1632581_at:729:709; Interrogation_Position=1013; Antisense; TTCACGACGGTAACAGTGCGCGGCA
>probe:Drosophila_2:1632581_at:614:629; Interrogation_Position=1042; Antisense; TCCTGCGACTTTTGCTGGCGGAGAT
>probe:Drosophila_2:1632581_at:482:411; Interrogation_Position=1071; Antisense; GACGCTGGAGTTGCTGAAGCTTCAT
>probe:Drosophila_2:1632581_at:629:207; Interrogation_Position=1087; Antisense; AAGCTTCATAAACTGGTTCACCTCC
>probe:Drosophila_2:1632581_at:219:511; Interrogation_Position=604; Antisense; GTGACCATTTGCGAGGAGTGCGACC
>probe:Drosophila_2:1632581_at:72:325; Interrogation_Position=623; Antisense; GCGACCGACGGTTTCTTAACGAGCG
>probe:Drosophila_2:1632581_at:187:527; Interrogation_Position=681; Antisense; GGGACCCAATCCGAATGTTTGTCAT
>probe:Drosophila_2:1632581_at:591:205; Interrogation_Position=736; Antisense; AAGCTAGAACAACACCAGGCACGGT
>probe:Drosophila_2:1632581_at:531:665; Interrogation_Position=802; Antisense; TACAATGCACCTTCCAAGTGGGACT
>probe:Drosophila_2:1632581_at:602:191; Interrogation_Position=862; Antisense; AACTATATCTGCGAGCTGTGCGGGC
>probe:Drosophila_2:1632581_at:334:595; Interrogation_Position=878; Antisense; TGTGCGGGCACAGCTCGAAGACCAG
>probe:Drosophila_2:1632581_at:156:391; Interrogation_Position=942; Antisense; GAAACTATGTTGTCCGCACTGCAGC
>probe:Drosophila_2:1632581_at:48:285; Interrogation_Position=960; Antisense; CTGCAGCCGGCAATTTCGAGAGAAT
>probe:Drosophila_2:1632581_at:687:353; Interrogation_Position=986; Antisense; GCACCTTGAAGAGTCACATCCGGAA

Paste this into a BLAST search page for me
TTCACGACGGTAACAGTGCGCGGCATCCTGCGACTTTTGCTGGCGGAGATGACGCTGGAGTTGCTGAAGCTTCATAAGCTTCATAAACTGGTTCACCTCCGTGACCATTTGCGAGGAGTGCGACCGCGACCGACGGTTTCTTAACGAGCGGGGACCCAATCCGAATGTTTGTCATAAGCTAGAACAACACCAGGCACGGTTACAATGCACCTTCCAAGTGGGACTAACTATATCTGCGAGCTGTGCGGGCTGTGCGGGCACAGCTCGAAGACCAGGAAACTATGTTGTCCGCACTGCAGCCTGCAGCCGGCAATTTCGAGAGAATGCACCTTGAAGAGTCACATCCGGAA

Full Affymetrix probeset data:

Annotations for 1632581_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720