Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632582_at:

>probe:Drosophila_2:1632582_at:39:445; Interrogation_Position=3016; Antisense; GATGAGGTATCCGAGCTGCCGAATG
>probe:Drosophila_2:1632582_at:701:293; Interrogation_Position=3060; Antisense; CGAGGGCGGATCCAACTACAGTGTA
>probe:Drosophila_2:1632582_at:157:437; Interrogation_Position=3144; Antisense; GATGGACGAGGCTACCGCAAATGTA
>probe:Drosophila_2:1632582_at:368:665; Interrogation_Position=3191; Antisense; TACAATCCACCATTCGCAGGAAGTT
>probe:Drosophila_2:1632582_at:552:93; Interrogation_Position=3228; Antisense; AGTTCTGACCATAGCTCACAGGTTG
>probe:Drosophila_2:1632582_at:213:293; Interrogation_Position=3257; Antisense; CGATCATCGATTCGGACAGGGTCAT
>probe:Drosophila_2:1632582_at:725:713; Interrogation_Position=3284; Antisense; TTCTGGACGCTGGTACTCTAGTGGA
>probe:Drosophila_2:1632582_at:105:639; Interrogation_Position=3311; Antisense; TCGGATCACCATTCGAACTACTGAC
>probe:Drosophila_2:1632582_at:274:385; Interrogation_Position=3325; Antisense; GAACTACTGACCCAATCGTGGAGCA
>probe:Drosophila_2:1632582_at:396:495; Interrogation_Position=3352; Antisense; GTCTTTTACGGGATGGTGCTCCAGA
>probe:Drosophila_2:1632582_at:467:599; Interrogation_Position=3368; Antisense; TGCTCCAGACGGGTCGGTCGAGTTT
>probe:Drosophila_2:1632582_at:708:429; Interrogation_Position=3387; Antisense; GAGTTTCGAGCACCTTCTGAAGCTG
>probe:Drosophila_2:1632582_at:22:379; Interrogation_Position=3405; Antisense; GAAGCTGGCACTTGAGGCCCACGAA
>probe:Drosophila_2:1632582_at:570:439; Interrogation_Position=3418; Antisense; GAGGCCCACGAAAGAAGACTGCTAT

Paste this into a BLAST search page for me
GATGAGGTATCCGAGCTGCCGAATGCGAGGGCGGATCCAACTACAGTGTAGATGGACGAGGCTACCGCAAATGTATACAATCCACCATTCGCAGGAAGTTAGTTCTGACCATAGCTCACAGGTTGCGATCATCGATTCGGACAGGGTCATTTCTGGACGCTGGTACTCTAGTGGATCGGATCACCATTCGAACTACTGACGAACTACTGACCCAATCGTGGAGCAGTCTTTTACGGGATGGTGCTCCAGATGCTCCAGACGGGTCGGTCGAGTTTGAGTTTCGAGCACCTTCTGAAGCTGGAAGCTGGCACTTGAGGCCCACGAAGAGGCCCACGAAAGAAGACTGCTAT

Full Affymetrix probeset data:

Annotations for 1632582_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime