FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632583_at:

>probe:Drosophila_2:1632583_at:520:365; Interrogation_Position=334; Antisense; GAATACGAGCCAACTTGAAGCCGAT
>probe:Drosophila_2:1632583_at:660:613; Interrogation_Position=349; Antisense; TGAAGCCGATGAGCGAGCGCATCCA
>probe:Drosophila_2:1632583_at:123:189; Interrogation_Position=373; Antisense; AACACCATCCCAATTACCTGAAGAC
>probe:Drosophila_2:1632583_at:320:43; Interrogation_Position=408; Antisense; ATCGATCGAATGAACTGCTCCACCA
>probe:Drosophila_2:1632583_at:257:223; Interrogation_Position=489; Antisense; AAGGGATCCCCTTTGATAGTCTTGG
>probe:Drosophila_2:1632583_at:591:251; Interrogation_Position=539; Antisense; CAAGCCCACGGCCATAATGACTATG
>probe:Drosophila_2:1632583_at:25:85; Interrogation_Position=587; Antisense; AGTGGTTAAGTTGCATTCGCGCGAA
>probe:Drosophila_2:1632583_at:495:495; Interrogation_Position=613; Antisense; GTCTGAATTTCGACTGTATTACCGT
>probe:Drosophila_2:1632583_at:481:481; Interrogation_Position=628; Antisense; GTATTACCGTGTGGTCAGCCAAGTT
>probe:Drosophila_2:1632583_at:608:519; Interrogation_Position=698; Antisense; GTGGACCTTCAACTGCACCAAGGAA
>probe:Drosophila_2:1632583_at:651:651; Interrogation_Position=727; Antisense; TCAAGGTTCCAAAACTGCCAGCTCA
>probe:Drosophila_2:1632583_at:169:55; Interrogation_Position=790; Antisense; ATGAAGTCCACGTCATTGGCGGAAA
>probe:Drosophila_2:1632583_at:206:147; Interrogation_Position=822; Antisense; ACTATAGCGTTTCCAATCGTAGATA
>probe:Drosophila_2:1632583_at:38:487; Interrogation_Position=840; Antisense; GTAGATACTTCTTGAGCTGAGCTTT

Paste this into a BLAST search page for me
GAATACGAGCCAACTTGAAGCCGATTGAAGCCGATGAGCGAGCGCATCCAAACACCATCCCAATTACCTGAAGACATCGATCGAATGAACTGCTCCACCAAAGGGATCCCCTTTGATAGTCTTGGCAAGCCCACGGCCATAATGACTATGAGTGGTTAAGTTGCATTCGCGCGAAGTCTGAATTTCGACTGTATTACCGTGTATTACCGTGTGGTCAGCCAAGTTGTGGACCTTCAACTGCACCAAGGAATCAAGGTTCCAAAACTGCCAGCTCAATGAAGTCCACGTCATTGGCGGAAAACTATAGCGTTTCCAATCGTAGATAGTAGATACTTCTTGAGCTGAGCTTT

Full Affymetrix probeset data:

Annotations for 1632583_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720