FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632584_at:

>probe:Drosophila_2:1632584_at:135:79; Interrogation_Position=1012; Antisense; AGGATCTAATGCTTGGACCCGTGAC
>probe:Drosophila_2:1632584_at:577:129; Interrogation_Position=1089; Antisense; ACCTTCACCAAGCTGATGGGCGATT
>probe:Drosophila_2:1632584_at:54:613; Interrogation_Position=1142; Antisense; TGAACTGCTGAACAACACCACCGTA
>probe:Drosophila_2:1632584_at:676:435; Interrogation_Position=1186; Antisense; GAGGACTGGACCTGATTTGCGCCAC
>probe:Drosophila_2:1632584_at:400:553; Interrogation_Position=1215; Antisense; GGAGCCGTCAACTGGATCGAAGCAA
>probe:Drosophila_2:1632584_at:376:111; Interrogation_Position=1235; Antisense; AGCAATGGAATGGTCCGCCAAGCCA
>probe:Drosophila_2:1632584_at:720:359; Interrogation_Position=1285; Antisense; GAATCACCGTAGATCGAGTTCTCGA
>probe:Drosophila_2:1632584_at:465:213; Interrogation_Position=1320; Antisense; AAGACCTATGGCAACTTCAGCATGT
>probe:Drosophila_2:1632584_at:127:649; Interrogation_Position=1336; Antisense; TCAGCATGTTTTGGGTCAACCGGGC
>probe:Drosophila_2:1632584_at:366:591; Interrogation_Position=1361; Antisense; TGGTCACATGGTTCCTGCCGATAAT
>probe:Drosophila_2:1632584_at:606:325; Interrogation_Position=1409; Antisense; GCGACACTTCACCAAATTCGGTTAA
>probe:Drosophila_2:1632584_at:525:467; Interrogation_Position=920; Antisense; GTTGATGTCCAGAGCTGCCATGACT
>probe:Drosophila_2:1632584_at:149:145; Interrogation_Position=942; Antisense; ACTCCGGAGGAGGTCATGTATCGCA
>probe:Drosophila_2:1632584_at:407:601; Interrogation_Position=958; Antisense; TGTATCGCACCCTCGTGAAATTCGA

Paste this into a BLAST search page for me
AGGATCTAATGCTTGGACCCGTGACACCTTCACCAAGCTGATGGGCGATTTGAACTGCTGAACAACACCACCGTAGAGGACTGGACCTGATTTGCGCCACGGAGCCGTCAACTGGATCGAAGCAAAGCAATGGAATGGTCCGCCAAGCCAGAATCACCGTAGATCGAGTTCTCGAAAGACCTATGGCAACTTCAGCATGTTCAGCATGTTTTGGGTCAACCGGGCTGGTCACATGGTTCCTGCCGATAATGCGACACTTCACCAAATTCGGTTAAGTTGATGTCCAGAGCTGCCATGACTACTCCGGAGGAGGTCATGTATCGCATGTATCGCACCCTCGTGAAATTCGA

Full Affymetrix probeset data:

Annotations for 1632584_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720