FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632586_at:

>probe:Drosophila_2:1632586_at:708:193; Interrogation_Position=1279; Antisense; AACGAACTTAATGCCACCCTGCGTA
>probe:Drosophila_2:1632586_at:177:551; Interrogation_Position=1332; Antisense; GGAGTACACCCGCAGGATACATGAA
>probe:Drosophila_2:1632586_at:34:257; Interrogation_Position=1395; Antisense; CAAAGTTCTGGATGACACGCGACAA
>probe:Drosophila_2:1632586_at:283:263; Interrogation_Position=1429; Antisense; CAGCTTAATGTCGTGGGTGCCCAGT
>probe:Drosophila_2:1632586_at:277:93; Interrogation_Position=1463; Antisense; AGTTCAACTACACGGACGACCTGCT
>probe:Drosophila_2:1632586_at:97:209; Interrogation_Position=1501; Antisense; AAGCATGATCTCCACGCGAAGCGGG
>probe:Drosophila_2:1632586_at:292:325; Interrogation_Position=1516; Antisense; GCGAAGCGGGCCTACAAGCTACTGG
>probe:Drosophila_2:1632586_at:582:231; Interrogation_Position=1561; Antisense; AATGAGCTGGTCGAGTGCGTCTCCC
>probe:Drosophila_2:1632586_at:656:349; Interrogation_Position=1605; Antisense; GCAGATCCGCGAACTTGAGGTCCAA
>probe:Drosophila_2:1632586_at:680:375; Interrogation_Position=1647; Antisense; GAAGAACGTGCTGACCAGTCTGCAG
>probe:Drosophila_2:1632586_at:299:97; Interrogation_Position=1673; Antisense; AGATCACCGGCGATATCCAGAAGTT
>probe:Drosophila_2:1632586_at:25:115; Interrogation_Position=1700; Antisense; AGCAGCATATCCAGGAGCTCCAGGA
>probe:Drosophila_2:1632586_at:356:705; Interrogation_Position=1765; Antisense; TTACGCGGAATCACTTGTTTACCAG
>probe:Drosophila_2:1632586_at:297:261; Interrogation_Position=1816; Antisense; CACGCCAAGCGTTCATTTTATTAGT

Paste this into a BLAST search page for me
AACGAACTTAATGCCACCCTGCGTAGGAGTACACCCGCAGGATACATGAACAAAGTTCTGGATGACACGCGACAACAGCTTAATGTCGTGGGTGCCCAGTAGTTCAACTACACGGACGACCTGCTAAGCATGATCTCCACGCGAAGCGGGGCGAAGCGGGCCTACAAGCTACTGGAATGAGCTGGTCGAGTGCGTCTCCCGCAGATCCGCGAACTTGAGGTCCAAGAAGAACGTGCTGACCAGTCTGCAGAGATCACCGGCGATATCCAGAAGTTAGCAGCATATCCAGGAGCTCCAGGATTACGCGGAATCACTTGTTTACCAGCACGCCAAGCGTTCATTTTATTAGT

Full Affymetrix probeset data:

Annotations for 1632586_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720