FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632588_at:

>probe:Drosophila_2:1632588_at:464:181; Interrogation_Position=105; Antisense; AAAACTCCAAGCCAAGCCGATTCCA
>probe:Drosophila_2:1632588_at:61:465; Interrogation_Position=123; Antisense; GATTCCACGGCTAAATCCGAGGCCA
>probe:Drosophila_2:1632588_at:491:173; Interrogation_Position=147; Antisense; AAAGCTGGCTGATGCGCTGCTGAAT
>probe:Drosophila_2:1632588_at:6:443; Interrogation_Position=204; Antisense; GATGTTGAACCTGAGTCCAAAGTCA
>probe:Drosophila_2:1632588_at:475:641; Interrogation_Position=23; Antisense; TCTGTCGCCCATCACGGATTATGTC
>probe:Drosophila_2:1632588_at:257:439; Interrogation_Position=241; Antisense; GAGGCTGAGCAGAGTCGCAGTCATC
>probe:Drosophila_2:1632588_at:339:87; Interrogation_Position=259; Antisense; AGTCATCCGCATCTAGCATTGTCAG
>probe:Drosophila_2:1632588_at:638:343; Interrogation_Position=274; Antisense; GCATTGTCAGGCTTTATGCCGTTTG
>probe:Drosophila_2:1632588_at:362:49; Interrogation_Position=289; Antisense; ATGCCGTTTGCAGTTTGCCGTTTGC
>probe:Drosophila_2:1632588_at:260:319; Interrogation_Position=312; Antisense; GCCGTTTGGCGTGGCATGCGAAATA
>probe:Drosophila_2:1632588_at:544:289; Interrogation_Position=37; Antisense; CGGATTATGTCCGTGCGCATTAATT
>probe:Drosophila_2:1632588_at:489:503; Interrogation_Position=45; Antisense; GTCCGTGCGCATTAATTTGCTGGAT
>probe:Drosophila_2:1632588_at:542:15; Interrogation_Position=59; Antisense; ATTTGCTGGATGAAACCGAGTTTAT
>probe:Drosophila_2:1632588_at:670:29; Interrogation_Position=82; Antisense; ATACACGAGATCAAGCTAGGGCCAA

Paste this into a BLAST search page for me
AAAACTCCAAGCCAAGCCGATTCCAGATTCCACGGCTAAATCCGAGGCCAAAAGCTGGCTGATGCGCTGCTGAATGATGTTGAACCTGAGTCCAAAGTCATCTGTCGCCCATCACGGATTATGTCGAGGCTGAGCAGAGTCGCAGTCATCAGTCATCCGCATCTAGCATTGTCAGGCATTGTCAGGCTTTATGCCGTTTGATGCCGTTTGCAGTTTGCCGTTTGCGCCGTTTGGCGTGGCATGCGAAATACGGATTATGTCCGTGCGCATTAATTGTCCGTGCGCATTAATTTGCTGGATATTTGCTGGATGAAACCGAGTTTATATACACGAGATCAAGCTAGGGCCAA

Full Affymetrix probeset data:

Annotations for 1632588_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720