Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632589_at:

>probe:Drosophila_2:1632589_at:190:617; Interrogation_Position=2260; Antisense; TGCACGAGCATCTTAGTCAAAACTT
>probe:Drosophila_2:1632589_at:192:83; Interrogation_Position=2306; Antisense; AGTGGCGCAGCACGATCGTTTGTCA
>probe:Drosophila_2:1632589_at:164:481; Interrogation_Position=2323; Antisense; GTTTGTCACAGCCTTTGCCGAATCA
>probe:Drosophila_2:1632589_at:687:365; Interrogation_Position=2342; Antisense; GAATCACCTGGGTCTGGTGCAGCCC
>probe:Drosophila_2:1632589_at:387:77; Interrogation_Position=2374; Antisense; AGGAGGAGATCCAAACCGCCCAGCA
>probe:Drosophila_2:1632589_at:28:691; Interrogation_Position=2420; Antisense; TTTGGCTAAGAAGTTGCCGCCTTCC
>probe:Drosophila_2:1632589_at:696:63; Interrogation_Position=2478; Antisense; ATGGGCATGTCCTATGCTGGCTTGC
>probe:Drosophila_2:1632589_at:322:469; Interrogation_Position=2573; Antisense; GTTGCAACCTGTGGCCATGGAGATC
>probe:Drosophila_2:1632589_at:183:425; Interrogation_Position=2658; Antisense; GAGAGCGGATCTGGCCTCCATTCTG
>probe:Drosophila_2:1632589_at:559:47; Interrogation_Position=2686; Antisense; ATCCGGCGGATGACAACAGCATTGT
>probe:Drosophila_2:1632589_at:230:345; Interrogation_Position=2704; Antisense; GCATTGTTGCTCAGCTGTTGCTGAA
>probe:Drosophila_2:1632589_at:616:449; Interrogation_Position=2735; Antisense; GATCGGGAAATCTCCAAGACGCGCG
>probe:Drosophila_2:1632589_at:372:213; Interrogation_Position=2750; Antisense; AAGACGCGCGCTATGTTTATAATGT
>probe:Drosophila_2:1632589_at:111:687; Interrogation_Position=2806; Antisense; TATATTCAATGCGTTGGCACTCTAA

Paste this into a BLAST search page for me
TGCACGAGCATCTTAGTCAAAACTTAGTGGCGCAGCACGATCGTTTGTCAGTTTGTCACAGCCTTTGCCGAATCAGAATCACCTGGGTCTGGTGCAGCCCAGGAGGAGATCCAAACCGCCCAGCATTTGGCTAAGAAGTTGCCGCCTTCCATGGGCATGTCCTATGCTGGCTTGCGTTGCAACCTGTGGCCATGGAGATCGAGAGCGGATCTGGCCTCCATTCTGATCCGGCGGATGACAACAGCATTGTGCATTGTTGCTCAGCTGTTGCTGAAGATCGGGAAATCTCCAAGACGCGCGAAGACGCGCGCTATGTTTATAATGTTATATTCAATGCGTTGGCACTCTAA

Full Affymetrix probeset data:

Annotations for 1632589_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime