Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632590_at:

>probe:Drosophila_2:1632590_at:675:583; Interrogation_Position=2813; Antisense; TGGCATTCGTATCCTGGCTGCTTTG
>probe:Drosophila_2:1632590_at:670:305; Interrogation_Position=2825; Antisense; CCTGGCTGCTTTGGCGATGGGTAAA
>probe:Drosophila_2:1632590_at:391:665; Interrogation_Position=2846; Antisense; TAAATTGAAGCCCAAGTTCGCCGAG
>probe:Drosophila_2:1632590_at:427:529; Interrogation_Position=2905; Antisense; GGGATGCTATTGTTAAACGCGCCAT
>probe:Drosophila_2:1632590_at:126:663; Interrogation_Position=2918; Antisense; TAAACGCGCCATGGATCTGCTGTTG
>probe:Drosophila_2:1632590_at:424:39; Interrogation_Position=2932; Antisense; ATCTGCTGTTGCTCTATCACGAAAG
>probe:Drosophila_2:1632590_at:313:353; Interrogation_Position=2976; Antisense; GCAGCTGTAGCCGTTACCCTAAAGG
>probe:Drosophila_2:1632590_at:469:671; Interrogation_Position=2990; Antisense; TACCCTAAAGGTCTTGGCCAAATCT
>probe:Drosophila_2:1632590_at:556:579; Interrogation_Position=3005; Antisense; GGCCAAATCTCATCCAGAAGCCTGG
>probe:Drosophila_2:1632590_at:463:377; Interrogation_Position=3021; Antisense; GAAGCCTGGGAGGAACGCTATCAAC
>probe:Drosophila_2:1632590_at:370:195; Interrogation_Position=3043; Antisense; AACGGGCTTTACCTATGGCTCAGAA
>probe:Drosophila_2:1632590_at:174:223; Interrogation_Position=3069; Antisense; AAGGATTTACTCACCGAACTCTATG
>probe:Drosophila_2:1632590_at:548:435; Interrogation_Position=3126; Antisense; GAGGTTACGTCAGCATCACAAGATT
>probe:Drosophila_2:1632590_at:550:665; Interrogation_Position=3320; Antisense; TACATATATCCACTTCTCAGAACGA

Paste this into a BLAST search page for me
TGGCATTCGTATCCTGGCTGCTTTGCCTGGCTGCTTTGGCGATGGGTAAATAAATTGAAGCCCAAGTTCGCCGAGGGGATGCTATTGTTAAACGCGCCATTAAACGCGCCATGGATCTGCTGTTGATCTGCTGTTGCTCTATCACGAAAGGCAGCTGTAGCCGTTACCCTAAAGGTACCCTAAAGGTCTTGGCCAAATCTGGCCAAATCTCATCCAGAAGCCTGGGAAGCCTGGGAGGAACGCTATCAACAACGGGCTTTACCTATGGCTCAGAAAAGGATTTACTCACCGAACTCTATGGAGGTTACGTCAGCATCACAAGATTTACATATATCCACTTCTCAGAACGA

Full Affymetrix probeset data:

Annotations for 1632590_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime