Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632591_at:

>probe:Drosophila_2:1632591_at:424:635; Interrogation_Position=103; Antisense; TCGCTAGCTCTAGTGTTCTGTGTTT
>probe:Drosophila_2:1632591_at:9:721; Interrogation_Position=137; Antisense; TTGCGGCAGCTGCTCCTGAAAAAAC
>probe:Drosophila_2:1632591_at:71:727; Interrogation_Position=18; Antisense; TTGAGTTGCGCCTTTGATCGTACCA
>probe:Drosophila_2:1632591_at:179:373; Interrogation_Position=196; Antisense; GAAGTTCTGGGCAACAACCGAGTGT
>probe:Drosophila_2:1632591_at:287:529; Interrogation_Position=222; Antisense; GGGTAATTATCTCAAGTGCCTGATG
>probe:Drosophila_2:1632591_at:477:559; Interrogation_Position=246; Antisense; GGACAAGGGCCCATGCACAGCAGAG
>probe:Drosophila_2:1632591_at:521:433; Interrogation_Position=268; Antisense; GAGGGTCGTGAACTTAAGCGCCTTT
>probe:Drosophila_2:1632591_at:441:645; Interrogation_Position=306; Antisense; TCATTCCGACTGCTCAAAGTGCACG
>probe:Drosophila_2:1632591_at:205:167; Interrogation_Position=382; Antisense; AAAGCCGGCGAATGGAAGCTCCTCC
>probe:Drosophila_2:1632591_at:117:379; Interrogation_Position=396; Antisense; GAAGCTCCTCCTGAACAAGTACGAT
>probe:Drosophila_2:1632591_at:385:449; Interrogation_Position=418; Antisense; GATCCCCAAGGCATCTACAGAGCAA
>probe:Drosophila_2:1632591_at:554:137; Interrogation_Position=446; Antisense; ACGAGGGACACTGAGCGCTTTGCTT
>probe:Drosophila_2:1632591_at:128:345; Interrogation_Position=467; Antisense; GCTTGTCCACCAAATGCACTAATTT
>probe:Drosophila_2:1632591_at:482:45; Interrogation_Position=84; Antisense; ATCCTCCAAGATGAAAGCCTCGCTA

Paste this into a BLAST search page for me
TCGCTAGCTCTAGTGTTCTGTGTTTTTGCGGCAGCTGCTCCTGAAAAAACTTGAGTTGCGCCTTTGATCGTACCAGAAGTTCTGGGCAACAACCGAGTGTGGGTAATTATCTCAAGTGCCTGATGGGACAAGGGCCCATGCACAGCAGAGGAGGGTCGTGAACTTAAGCGCCTTTTCATTCCGACTGCTCAAAGTGCACGAAAGCCGGCGAATGGAAGCTCCTCCGAAGCTCCTCCTGAACAAGTACGATGATCCCCAAGGCATCTACAGAGCAAACGAGGGACACTGAGCGCTTTGCTTGCTTGTCCACCAAATGCACTAATTTATCCTCCAAGATGAAAGCCTCGCTA

Full Affymetrix probeset data:

Annotations for 1632591_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime