FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632593_at:

>probe:Drosophila_2:1632593_at:580:119; Interrogation_Position=294; Antisense; AGCTGGCGTACAATCACAAGTTCCG
>probe:Drosophila_2:1632593_at:218:159; Interrogation_Position=309; Antisense; ACAAGTTCCGCCGAGCTGATAATTG
>probe:Drosophila_2:1632593_at:144:183; Interrogation_Position=340; Antisense; AAAACTGGCCAACGGCACTTGCGAA
>probe:Drosophila_2:1632593_at:538:345; Interrogation_Position=354; Antisense; GCACTTGCGAACTACCCAACAATGG
>probe:Drosophila_2:1632593_at:573:247; Interrogation_Position=440; Antisense; AATTGCGCCGATTGTGTGGGACCCA
>probe:Drosophila_2:1632593_at:391:455; Interrogation_Position=485; Antisense; GATAATCTCAAATCCCTGAGCGCCA
>probe:Drosophila_2:1632593_at:638:183; Interrogation_Position=522; Antisense; AAAATGTGGGTGACTTTCTCTGCGG
>probe:Drosophila_2:1632593_at:246:695; Interrogation_Position=536; Antisense; TTTCTCTGCGGCTATATCTATCTGA
>probe:Drosophila_2:1632593_at:230:199; Interrogation_Position=582; Antisense; AACGAAGCCTGTTTGTCCATGTACC
>probe:Drosophila_2:1632593_at:363:61; Interrogation_Position=600; Antisense; ATGTACCTCCTGTAGATAGGCCATT
>probe:Drosophila_2:1632593_at:190:233; Interrogation_Position=669; Antisense; AATGCATTCAACAGGTGGTCGCTTT
>probe:Drosophila_2:1632593_at:61:343; Interrogation_Position=689; Antisense; GCTTTTGACTCCTGAATTCCGCAAA
>probe:Drosophila_2:1632593_at:532:689; Interrogation_Position=715; Antisense; TATTCTTCCAATATCTGTCTTTTTA
>probe:Drosophila_2:1632593_at:424:157; Interrogation_Position=866; Antisense; ACACAGTCTTTTTTGCGTTTACACA

Paste this into a BLAST search page for me
AGCTGGCGTACAATCACAAGTTCCGACAAGTTCCGCCGAGCTGATAATTGAAAACTGGCCAACGGCACTTGCGAAGCACTTGCGAACTACCCAACAATGGAATTGCGCCGATTGTGTGGGACCCAGATAATCTCAAATCCCTGAGCGCCAAAAATGTGGGTGACTTTCTCTGCGGTTTCTCTGCGGCTATATCTATCTGAAACGAAGCCTGTTTGTCCATGTACCATGTACCTCCTGTAGATAGGCCATTAATGCATTCAACAGGTGGTCGCTTTGCTTTTGACTCCTGAATTCCGCAAATATTCTTCCAATATCTGTCTTTTTAACACAGTCTTTTTTGCGTTTACACA

Full Affymetrix probeset data:

Annotations for 1632593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720