FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632594_at:

>probe:Drosophila_2:1632594_at:445:361; Interrogation_Position=1539; Antisense; GCAAGTTGAAGTGCCAGTACTGCGA
>probe:Drosophila_2:1632594_at:287:717; Interrogation_Position=1571; Antisense; TTCGCCGTGGATACCGACCTAAAGG
>probe:Drosophila_2:1632594_at:35:223; Interrogation_Position=1592; Antisense; AAGGTGCACACACTAATCCACACGG
>probe:Drosophila_2:1632594_at:107:129; Interrogation_Position=1680; Antisense; ACCACGTCAACGGAGTTCACCTGAA
>probe:Drosophila_2:1632594_at:442:471; Interrogation_Position=1694; Antisense; GTTCACCTGAACATTAGACCCTACA
>probe:Drosophila_2:1632594_at:212:673; Interrogation_Position=1708; Antisense; TAGACCCTACAGCTGCAATATGTGC
>probe:Drosophila_2:1632594_at:131:243; Interrogation_Position=1724; Antisense; AATATGTGCACCAAAACCTTCCGCA
>probe:Drosophila_2:1632594_at:466:209; Interrogation_Position=1748; Antisense; AAGAAGTTCGAGCTGGCCAACCATA
>probe:Drosophila_2:1632594_at:630:325; Interrogation_Position=1806; Antisense; GCGAGTACTGTGATGCTACGTTCTA
>probe:Drosophila_2:1632594_at:347:669; Interrogation_Position=1822; Antisense; TACGTTCTATGACCATTCTTCGCTT
>probe:Drosophila_2:1632594_at:479:97; Interrogation_Position=1868; Antisense; AGATCGGAATGAACTCTCGCCTTGA
>probe:Drosophila_2:1632594_at:449:281; Interrogation_Position=1883; Antisense; CTCGCCTTGAGGGACATTTTTAGAA
>probe:Drosophila_2:1632594_at:8:113; Interrogation_Position=2007; Antisense; AGCACTTACGGCTTTTGTGTATTTG
>probe:Drosophila_2:1632594_at:142:357; Interrogation_Position=2059; Antisense; GCACAAGCTTTTCCTTTTTCATACT

Paste this into a BLAST search page for me
GCAAGTTGAAGTGCCAGTACTGCGATTCGCCGTGGATACCGACCTAAAGGAAGGTGCACACACTAATCCACACGGACCACGTCAACGGAGTTCACCTGAAGTTCACCTGAACATTAGACCCTACATAGACCCTACAGCTGCAATATGTGCAATATGTGCACCAAAACCTTCCGCAAAGAAGTTCGAGCTGGCCAACCATAGCGAGTACTGTGATGCTACGTTCTATACGTTCTATGACCATTCTTCGCTTAGATCGGAATGAACTCTCGCCTTGACTCGCCTTGAGGGACATTTTTAGAAAGCACTTACGGCTTTTGTGTATTTGGCACAAGCTTTTCCTTTTTCATACT

Full Affymetrix probeset data:

Annotations for 1632594_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720