FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632595_at:

>probe:Drosophila_2:1632595_at:409:715; Interrogation_Position=2505; Antisense; TTCCGAGGAAGTCGTCACCGAGGCT
>probe:Drosophila_2:1632595_at:508:1; Interrogation_Position=2525; Antisense; AGGCTCCTTTGGAGGAGGCTCCAGT
>probe:Drosophila_2:1632595_at:535:437; Interrogation_Position=2551; Antisense; GAGGAAGCTTCTCAGGACTCTGCTG
>probe:Drosophila_2:1632595_at:294:75; Interrogation_Position=2564; Antisense; AGGACTCTGCTGTTTTGGCTGCCGA
>probe:Drosophila_2:1632595_at:34:701; Interrogation_Position=2576; Antisense; TTTTGGCTGCCGATGGTTACCAGTA
>probe:Drosophila_2:1632595_at:607:589; Interrogation_Position=2589; Antisense; TGGTTACCAGTACAAGACCGTGCGT
>probe:Drosophila_2:1632595_at:390:123; Interrogation_Position=2630; Antisense; AGCGCCGCGATGTCTCCGAGATTGC
>probe:Drosophila_2:1632595_at:140:47; Interrogation_Position=2696; Antisense; ATGCGCCCGTTGAGGAAGTGTCCCA
>probe:Drosophila_2:1632595_at:339:47; Interrogation_Position=2731; Antisense; ATCCTTGGCGACGAGGGCTACCGGT
>probe:Drosophila_2:1632595_at:115:319; Interrogation_Position=2789; Antisense; GCCGTGCCCTGTAAGTCTGGATGAC
>probe:Drosophila_2:1632595_at:348:499; Interrogation_Position=2803; Antisense; GTCTGGATGACTGCGAATACACTTG
>probe:Drosophila_2:1632595_at:132:29; Interrogation_Position=2819; Antisense; ATACACTTGTACCTGAACTTCTCGT
>probe:Drosophila_2:1632595_at:243:385; Interrogation_Position=2833; Antisense; GAACTTCTCGTTCGCGACTTGATTC
>probe:Drosophila_2:1632595_at:528:139; Interrogation_Position=2882; Antisense; ACTAGGCCGTAAGTTTTGCTATTAT

Paste this into a BLAST search page for me
TTCCGAGGAAGTCGTCACCGAGGCTAGGCTCCTTTGGAGGAGGCTCCAGTGAGGAAGCTTCTCAGGACTCTGCTGAGGACTCTGCTGTTTTGGCTGCCGATTTTGGCTGCCGATGGTTACCAGTATGGTTACCAGTACAAGACCGTGCGTAGCGCCGCGATGTCTCCGAGATTGCATGCGCCCGTTGAGGAAGTGTCCCAATCCTTGGCGACGAGGGCTACCGGTGCCGTGCCCTGTAAGTCTGGATGACGTCTGGATGACTGCGAATACACTTGATACACTTGTACCTGAACTTCTCGTGAACTTCTCGTTCGCGACTTGATTCACTAGGCCGTAAGTTTTGCTATTAT

Full Affymetrix probeset data:

Annotations for 1632595_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720