FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632596_at:

>probe:Drosophila_2:1632596_at:171:173; Interrogation_Position=1010; Antisense; AAAGACCGTGCGACTTGGCTGAGAA
>probe:Drosophila_2:1632596_at:383:111; Interrogation_Position=1031; Antisense; AGAATCAAAACTGGCTCTGCGTCCT
>probe:Drosophila_2:1632596_at:280:281; Interrogation_Position=1045; Antisense; CTCTGCGTCCTTGTTGATTATTGTA
>probe:Drosophila_2:1632596_at:521:495; Interrogation_Position=613; Antisense; GTCAGGCCAAATCTTTACACGCAGT
>probe:Drosophila_2:1632596_at:494:709; Interrogation_Position=627; Antisense; TTACACGCAGTTATTGGCGCCCTGG
>probe:Drosophila_2:1632596_at:27:435; Interrogation_Position=671; Antisense; GAGGGCTTTCATTTTTGTACGCGAT
>probe:Drosophila_2:1632596_at:200:601; Interrogation_Position=686; Antisense; TGTACGCGATTTCATCTGCACGCAA
>probe:Drosophila_2:1632596_at:116:435; Interrogation_Position=732; Antisense; GAGGTGTGGACTCCCCAGGAACCAA
>probe:Drosophila_2:1632596_at:39:301; Interrogation_Position=810; Antisense; CGCCTGCTTGGAGACTGCGGAAAGA
>probe:Drosophila_2:1632596_at:716:391; Interrogation_Position=829; Antisense; GAAAGAACACTGTGCTAGCCGCCTA
>probe:Drosophila_2:1632596_at:660:251; Interrogation_Position=872; Antisense; CAACCGGCAGCTACTGGGCAAGGGA
>probe:Drosophila_2:1632596_at:431:617; Interrogation_Position=946; Antisense; TGCAGAGCATCTTTGACACCCGCGA
>probe:Drosophila_2:1632596_at:554:391; Interrogation_Position=969; Antisense; GACAACCGGAGACCCTTTGACTTTG
>probe:Drosophila_2:1632596_at:213:403; Interrogation_Position=987; Antisense; GACTTTGCCATTCAGCTAGAACCAA

Paste this into a BLAST search page for me
AAAGACCGTGCGACTTGGCTGAGAAAGAATCAAAACTGGCTCTGCGTCCTCTCTGCGTCCTTGTTGATTATTGTAGTCAGGCCAAATCTTTACACGCAGTTTACACGCAGTTATTGGCGCCCTGGGAGGGCTTTCATTTTTGTACGCGATTGTACGCGATTTCATCTGCACGCAAGAGGTGTGGACTCCCCAGGAACCAACGCCTGCTTGGAGACTGCGGAAAGAGAAAGAACACTGTGCTAGCCGCCTACAACCGGCAGCTACTGGGCAAGGGATGCAGAGCATCTTTGACACCCGCGAGACAACCGGAGACCCTTTGACTTTGGACTTTGCCATTCAGCTAGAACCAA

Full Affymetrix probeset data:

Annotations for 1632596_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720