FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632597_at:

>probe:Drosophila_2:1632597_at:724:299; Interrogation_Position=116; Antisense; CCCGGCTTCAGAGGCGGTCGAATGT
>probe:Drosophila_2:1632597_at:674:61; Interrogation_Position=13; Antisense; ATGTCGGCTAGCTACACACGCCTGT
>probe:Drosophila_2:1632597_at:384:175; Interrogation_Position=176; Antisense; AAACCCTCTGCCAGGCTATTGATGG
>probe:Drosophila_2:1632597_at:250:441; Interrogation_Position=196; Antisense; GATGGCAATAGTCCCATCCACAGAT
>probe:Drosophila_2:1632597_at:237:15; Interrogation_Position=253; Antisense; ATTAGGCCATATACTCGCGAATCCG
>probe:Drosophila_2:1632597_at:563:633; Interrogation_Position=267; Antisense; TCGCGAATCCGATCCCAGTGATGGG
>probe:Drosophila_2:1632597_at:358:285; Interrogation_Position=34; Antisense; CTGTTCCGCGTTTTGTTCGTGATAA
>probe:Drosophila_2:1632597_at:579:397; Interrogation_Position=361; Antisense; GACAACCGACCCGTTGAGGGCGAGT
>probe:Drosophila_2:1632597_at:48:433; Interrogation_Position=382; Antisense; GAGTCCTCGATTTATGTGCTGCCAA
>probe:Drosophila_2:1632597_at:169:509; Interrogation_Position=397; Antisense; GTGCTGCCAATAAATTTGCCCAACA
>probe:Drosophila_2:1632597_at:21:583; Interrogation_Position=425; Antisense; TGGCCCCGTCTAATGCAATATTTAC
>probe:Drosophila_2:1632597_at:469:21; Interrogation_Position=442; Antisense; ATATTTACATCGCATCGGGCCAAAT
>probe:Drosophila_2:1632597_at:104:343; Interrogation_Position=65; Antisense; TCAAGTTACTCCTCCTTTTGGGACT
>probe:Drosophila_2:1632597_at:528:557; Interrogation_Position=85; Antisense; GGACTCCTTTTGGACAGCTACGATG

Paste this into a BLAST search page for me
CCCGGCTTCAGAGGCGGTCGAATGTATGTCGGCTAGCTACACACGCCTGTAAACCCTCTGCCAGGCTATTGATGGGATGGCAATAGTCCCATCCACAGATATTAGGCCATATACTCGCGAATCCGTCGCGAATCCGATCCCAGTGATGGGCTGTTCCGCGTTTTGTTCGTGATAAGACAACCGACCCGTTGAGGGCGAGTGAGTCCTCGATTTATGTGCTGCCAAGTGCTGCCAATAAATTTGCCCAACATGGCCCCGTCTAATGCAATATTTACATATTTACATCGCATCGGGCCAAATTCAAGTTACTCCTCCTTTTGGGACTGGACTCCTTTTGGACAGCTACGATG

Full Affymetrix probeset data:

Annotations for 1632597_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720