FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632605_at:

>probe:Drosophila_2:1632605_at:147:505; Interrogation_Position=525; Antisense; GTCCGTCAAGCAGCCGAGTATGCAT
>probe:Drosophila_2:1632605_at:202:411; Interrogation_Position=588; Antisense; GACGAAGCCACGAATGCGCTCAAAA
>probe:Drosophila_2:1632605_at:592:161; Interrogation_Position=652; Antisense; AAATTGGACGCCTAGTTGTGGCCTT
>probe:Drosophila_2:1632605_at:52:695; Interrogation_Position=667; Antisense; TTGTGGCCTTGGTGATGGTCCAACT
>probe:Drosophila_2:1632605_at:223:1; Interrogation_Position=702; Antisense; GATTCCGTGGAAGCCGAAAAGACCT
>probe:Drosophila_2:1632605_at:591:713; Interrogation_Position=781; Antisense; TTCTGCAAGCCTTCGATGACGAGGA
>probe:Drosophila_2:1632605_at:671:137; Interrogation_Position=799; Antisense; ACGAGGATCCCGAGTTAGCTGCTAG
>probe:Drosophila_2:1632605_at:178:585; Interrogation_Position=829; Antisense; TGGCATCCCCATTCATACGACATAT
>probe:Drosophila_2:1632605_at:50:469; Interrogation_Position=858; Antisense; GTTGAGTACGCTATTCTATCTAAAA
>probe:Drosophila_2:1632605_at:536:181; Interrogation_Position=880; Antisense; AAAACATTCCACTACCTCAGGGTAT
>probe:Drosophila_2:1632605_at:444:227; Interrogation_Position=918; Antisense; AAGGCTGGCGACACTGCTGCTGAAA
>probe:Drosophila_2:1632605_at:618:621; Interrogation_Position=932; Antisense; TGCTGCTGAAACCAACGACGCCGAG
>probe:Drosophila_2:1632605_at:659:79; Interrogation_Position=962; Antisense; AGGTGGCTTGTGCTAAATTTCTTAA
>probe:Drosophila_2:1632605_at:418:229; Interrogation_Position=985; Antisense; AATGTTCGGTCTGCTTGTTAGTCAA

Paste this into a BLAST search page for me
GTCCGTCAAGCAGCCGAGTATGCATGACGAAGCCACGAATGCGCTCAAAAAAATTGGACGCCTAGTTGTGGCCTTTTGTGGCCTTGGTGATGGTCCAACTGATTCCGTGGAAGCCGAAAAGACCTTTCTGCAAGCCTTCGATGACGAGGAACGAGGATCCCGAGTTAGCTGCTAGTGGCATCCCCATTCATACGACATATGTTGAGTACGCTATTCTATCTAAAAAAAACATTCCACTACCTCAGGGTATAAGGCTGGCGACACTGCTGCTGAAATGCTGCTGAAACCAACGACGCCGAGAGGTGGCTTGTGCTAAATTTCTTAAAATGTTCGGTCTGCTTGTTAGTCAA

Full Affymetrix probeset data:

Annotations for 1632605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720