Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632606_a_at:

>probe:Drosophila_2:1632606_a_at:353:685; Interrogation_Position=118; Antisense; TATCAGTGATAAAGATGCGCCAGCT
>probe:Drosophila_2:1632606_a_at:362:207; Interrogation_Position=186; Antisense; AAGCTGGACAACCTGGAGACCCAGG
>probe:Drosophila_2:1632606_a_at:309:425; Interrogation_Position=201; Antisense; GAGACCCAGGCGAAGATCCGCACCG
>probe:Drosophila_2:1632606_a_at:255:335; Interrogation_Position=239; Antisense; GCTCGGCGTTTTGGCGGTCTTTCTG
>probe:Drosophila_2:1632606_a_at:357:471; Interrogation_Position=397; Antisense; GTTCGTCCATCCAAAAAGCATGTTT
>probe:Drosophila_2:1632606_a_at:428:519; Interrogation_Position=430; Antisense; GTGGATTTTCCATGACACGAACAAC
>probe:Drosophila_2:1632606_a_at:193:187; Interrogation_Position=449; Antisense; AACAACACCCTGCTGTTCAAGTGCA
>probe:Drosophila_2:1632606_a_at:263:703; Interrogation_Position=46; Antisense; TTTTGTTGCTCCACGCACACACATT
>probe:Drosophila_2:1632606_a_at:278:473; Interrogation_Position=463; Antisense; GTTCAAGTGCAGTTCCTGGGAATTT
>probe:Drosophila_2:1632606_a_at:506:227; Interrogation_Position=503; Antisense; AATGTATCCGAATTACGGTCGTTGG
>probe:Drosophila_2:1632606_a_at:228:297; Interrogation_Position=59; Antisense; CGCACACACATTCCGACGAGTGTTA
>probe:Drosophila_2:1632606_a_at:290:181; Interrogation_Position=592; Antisense; AAAACCGTAGCAGAGGCACTTCAAT
>probe:Drosophila_2:1632606_a_at:87:295; Interrogation_Position=75; Antisense; CGAGTGTTACACGTCACCAGATTAA
>probe:Drosophila_2:1632606_a_at:499:221; Interrogation_Position=99; Antisense; AAGGAACTATCGCAAAAACTATCAG

Paste this into a BLAST search page for me
TATCAGTGATAAAGATGCGCCAGCTAAGCTGGACAACCTGGAGACCCAGGGAGACCCAGGCGAAGATCCGCACCGGCTCGGCGTTTTGGCGGTCTTTCTGGTTCGTCCATCCAAAAAGCATGTTTGTGGATTTTCCATGACACGAACAACAACAACACCCTGCTGTTCAAGTGCATTTTGTTGCTCCACGCACACACATTGTTCAAGTGCAGTTCCTGGGAATTTAATGTATCCGAATTACGGTCGTTGGCGCACACACATTCCGACGAGTGTTAAAAACCGTAGCAGAGGCACTTCAATCGAGTGTTACACGTCACCAGATTAAAAGGAACTATCGCAAAAACTATCAG

Full Affymetrix probeset data:

Annotations for 1632606_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime