FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632607_at:

>probe:Drosophila_2:1632607_at:7:403; Interrogation_Position=101; Antisense; GACATCTTTTATGACTGCCGCAGTG
>probe:Drosophila_2:1632607_at:477:221; Interrogation_Position=168; Antisense; AAGTGATCTGCAAGCAAGCGCCTCG
>probe:Drosophila_2:1632607_at:513:205; Interrogation_Position=183; Antisense; AAGCGCCTCGATTTGACGATCCTGT
>probe:Drosophila_2:1632607_at:402:447; Interrogation_Position=200; Antisense; GATCCTGTCCAGATTCGGGCCGTTT
>probe:Drosophila_2:1632607_at:35:133; Interrogation_Position=245; Antisense; ACCCAGCGGTTGCTAAGGTGCTACG
>probe:Drosophila_2:1632607_at:610:505; Interrogation_Position=284; Antisense; GTGCCAACTCGTCCTTTGATGACAC
>probe:Drosophila_2:1632607_at:344:725; Interrogation_Position=299; Antisense; TTGATGACACTTTTCTATCCGGCCA
>probe:Drosophila_2:1632607_at:225:287; Interrogation_Position=326; Antisense; CTGGAGGTCAGTGCCCGTCTACATA
>probe:Drosophila_2:1632607_at:177:349; Interrogation_Position=382; Antisense; GCAGTGCAAGTTAATCGGCGACCCA
>probe:Drosophila_2:1632607_at:638:305; Interrogation_Position=412; Antisense; CCTGAGGCTGCCAATCGAACTGAAT
>probe:Drosophila_2:1632607_at:397:119; Interrogation_Position=443; Antisense; AGCGGCCAGGTCAAAGTCAACATCT
>probe:Drosophila_2:1632607_at:90:37; Interrogation_Position=464; Antisense; ATCTTCCAGCCCAAGTCAATTGGCA
>probe:Drosophila_2:1632607_at:304:373; Interrogation_Position=569; Antisense; GAAGTGTGTCCCGATTGCCAGGAAC
>probe:Drosophila_2:1632607_at:491:259; Interrogation_Position=631; Antisense; CACGTCTTGCTCACTTAGTTGTTTT

Paste this into a BLAST search page for me
GACATCTTTTATGACTGCCGCAGTGAAGTGATCTGCAAGCAAGCGCCTCGAAGCGCCTCGATTTGACGATCCTGTGATCCTGTCCAGATTCGGGCCGTTTACCCAGCGGTTGCTAAGGTGCTACGGTGCCAACTCGTCCTTTGATGACACTTGATGACACTTTTCTATCCGGCCACTGGAGGTCAGTGCCCGTCTACATAGCAGTGCAAGTTAATCGGCGACCCACCTGAGGCTGCCAATCGAACTGAATAGCGGCCAGGTCAAAGTCAACATCTATCTTCCAGCCCAAGTCAATTGGCAGAAGTGTGTCCCGATTGCCAGGAACCACGTCTTGCTCACTTAGTTGTTTT

Full Affymetrix probeset data:

Annotations for 1632607_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720