FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632610_at:

>probe:Drosophila_2:1632610_at:614:353; Interrogation_Position=1074; Antisense; GCACTTAAAGCTCCTGTTCACATGT
>probe:Drosophila_2:1632610_at:559:471; Interrogation_Position=1089; Antisense; GTTCACATGTGGAGGCTTATTCGAC
>probe:Drosophila_2:1632610_at:492:543; Interrogation_Position=1191; Antisense; GGATTTTGCTCTAATCGGCTACAGA
>probe:Drosophila_2:1632610_at:21:323; Interrogation_Position=642; Antisense; GCGCCATGTCCTTGAGCAGCTAAAG
>probe:Drosophila_2:1632610_at:122:213; Interrogation_Position=677; Antisense; AAGACTTCGACTGCGGAGCCAGGAT
>probe:Drosophila_2:1632610_at:718:11; Interrogation_Position=700; Antisense; ATTCAGGAGCTGTGCGTGACTTTAA
>probe:Drosophila_2:1632610_at:357:649; Interrogation_Position=785; Antisense; TCAGATGGTCCATGACTCTGCTGTT
>probe:Drosophila_2:1632610_at:137:147; Interrogation_Position=799; Antisense; ACTCTGCTGTTTCTCTACAATGGAC
>probe:Drosophila_2:1632610_at:385:67; Interrogation_Position=818; Antisense; ATGGACTTACCATTCTGCACGTTGT
>probe:Drosophila_2:1632610_at:268:355; Interrogation_Position=834; Antisense; GCACGTTGTCAACTGGGCTATCATT
>probe:Drosophila_2:1632610_at:326:3; Interrogation_Position=878; Antisense; ATTGCTGTCAACTCAATCGTTTGGG
>probe:Drosophila_2:1632610_at:412:531; Interrogation_Position=901; Antisense; GGGTCTATTACTTTTCTGTCGTTCA
>probe:Drosophila_2:1632610_at:271:713; Interrogation_Position=929; Antisense; TTCTGCTGACCTGCTTTTTTAGTGA
>probe:Drosophila_2:1632610_at:26:249; Interrogation_Position=999; Antisense; AATTGGATGCTTGCCTACAGCTGAA

Paste this into a BLAST search page for me
GCACTTAAAGCTCCTGTTCACATGTGTTCACATGTGGAGGCTTATTCGACGGATTTTGCTCTAATCGGCTACAGAGCGCCATGTCCTTGAGCAGCTAAAGAAGACTTCGACTGCGGAGCCAGGATATTCAGGAGCTGTGCGTGACTTTAATCAGATGGTCCATGACTCTGCTGTTACTCTGCTGTTTCTCTACAATGGACATGGACTTACCATTCTGCACGTTGTGCACGTTGTCAACTGGGCTATCATTATTGCTGTCAACTCAATCGTTTGGGGGGTCTATTACTTTTCTGTCGTTCATTCTGCTGACCTGCTTTTTTAGTGAAATTGGATGCTTGCCTACAGCTGAA

Full Affymetrix probeset data:

Annotations for 1632610_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720