FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632611_at:

>probe:Drosophila_2:1632611_at:373:661; Interrogation_Position=152; Antisense; TAAACCCCAACGCACCTGTGTTTGT
>probe:Drosophila_2:1632611_at:647:129; Interrogation_Position=165; Antisense; ACCTGTGTTTGTGCCCGACTTCAAG
>probe:Drosophila_2:1632611_at:527:443; Interrogation_Position=217; Antisense; GATGAGTTATCTACGTACACCCGGT
>probe:Drosophila_2:1632611_at:291:587; Interrogation_Position=241; Antisense; TGGAGTACGGCAACCTCGGAGGACA
>probe:Drosophila_2:1632611_at:328:547; Interrogation_Position=258; Antisense; GGAGGACATATGCTACGAGCCCCGT
>probe:Drosophila_2:1632611_at:461:475; Interrogation_Position=281; Antisense; GTTACGAGTCCATCTGGCGTGAGGC
>probe:Drosophila_2:1632611_at:11:583; Interrogation_Position=295; Antisense; TGGCGTGAGGCCAGCATCCAGCAGC
>probe:Drosophila_2:1632611_at:643:615; Interrogation_Position=329; Antisense; TGCGCCATCCGGGTTTCGTTTACAG
>probe:Drosophila_2:1632611_at:143:697; Interrogation_Position=347; Antisense; TTTACAGCCTGGATCCTGGCGAGGA
>probe:Drosophila_2:1632611_at:507:587; Interrogation_Position=386; Antisense; TGGAGTTTGACGAAGTCCAGGCCAT
>probe:Drosophila_2:1632611_at:254:23; Interrogation_Position=413; Antisense; ATATCGGAGCCGAGTCCTATGATCC
>probe:Drosophila_2:1632611_at:401:377; Interrogation_Position=446; Antisense; GAAGCACATCAGTTAGCCAGGCAAT
>probe:Drosophila_2:1632611_at:146:371; Interrogation_Position=525; Antisense; GAATGGCTTTCAGAATCGCCACTCC
>probe:Drosophila_2:1632611_at:444:255; Interrogation_Position=561; Antisense; CAAAAAGTGCTGTCTGGTCATGTAG

Paste this into a BLAST search page for me
TAAACCCCAACGCACCTGTGTTTGTACCTGTGTTTGTGCCCGACTTCAAGGATGAGTTATCTACGTACACCCGGTTGGAGTACGGCAACCTCGGAGGACAGGAGGACATATGCTACGAGCCCCGTGTTACGAGTCCATCTGGCGTGAGGCTGGCGTGAGGCCAGCATCCAGCAGCTGCGCCATCCGGGTTTCGTTTACAGTTTACAGCCTGGATCCTGGCGAGGATGGAGTTTGACGAAGTCCAGGCCATATATCGGAGCCGAGTCCTATGATCCGAAGCACATCAGTTAGCCAGGCAATGAATGGCTTTCAGAATCGCCACTCCCAAAAAGTGCTGTCTGGTCATGTAG

Full Affymetrix probeset data:

Annotations for 1632611_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720