FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632613_at:

>probe:Drosophila_2:1632613_at:516:353; Interrogation_Position=1002; Antisense; GCAGCTGGGCATCACGAAAATGTTT
>probe:Drosophila_2:1632613_at:55:477; Interrogation_Position=1023; Antisense; GTTTACGGACCAAGCTGAGTTTAGC
>probe:Drosophila_2:1632613_at:86:91; Interrogation_Position=1040; Antisense; AGTTTAGCAATCTGCTGGAATCCCC
>probe:Drosophila_2:1632613_at:669:515; Interrogation_Position=1078; Antisense; GTGTCCAAGGTGCTGCACAAGGCCA
>probe:Drosophila_2:1632613_at:563:57; Interrogation_Position=1156; Antisense; ATGATGACCCGCATGATGACCTTCC
>probe:Drosophila_2:1632613_at:482:307; Interrogation_Position=1205; Antisense; CCTTCCTCTACGTCATCTGGAATAA
>probe:Drosophila_2:1632613_at:195:577; Interrogation_Position=1249; Antisense; GGCGCCTTCGTTAAGGCTGCCTAAA
>probe:Drosophila_2:1632613_at:224:307; Interrogation_Position=1277; Antisense; CCATTTCTCACTTCTTTCGTATTGT
>probe:Drosophila_2:1632613_at:290:657; Interrogation_Position=1336; Antisense; TAAGCGCTCCATGATTAAATTACCC
>probe:Drosophila_2:1632613_at:378:343; Interrogation_Position=773; Antisense; GCTTCTTCGAAGATCTGGGCTGCAC
>probe:Drosophila_2:1632613_at:380:539; Interrogation_Position=865; Antisense; GGTATTTACGCCCTAGCCGAGAAGC
>probe:Drosophila_2:1632613_at:243:339; Interrogation_Position=888; Antisense; GCTCAAGACTGTGAACCTGGTGGAT
>probe:Drosophila_2:1632613_at:628:213; Interrogation_Position=935; Antisense; AAGAGGTCCATGTCAAGTTCCCCAA
>probe:Drosophila_2:1632613_at:55:221; Interrogation_Position=964; Antisense; AAGGTGGACTACTCCCTGGAATTGG

Paste this into a BLAST search page for me
GCAGCTGGGCATCACGAAAATGTTTGTTTACGGACCAAGCTGAGTTTAGCAGTTTAGCAATCTGCTGGAATCCCCGTGTCCAAGGTGCTGCACAAGGCCAATGATGACCCGCATGATGACCTTCCCCTTCCTCTACGTCATCTGGAATAAGGCGCCTTCGTTAAGGCTGCCTAAACCATTTCTCACTTCTTTCGTATTGTTAAGCGCTCCATGATTAAATTACCCGCTTCTTCGAAGATCTGGGCTGCACGGTATTTACGCCCTAGCCGAGAAGCGCTCAAGACTGTGAACCTGGTGGATAAGAGGTCCATGTCAAGTTCCCCAAAAGGTGGACTACTCCCTGGAATTGG

Full Affymetrix probeset data:

Annotations for 1632613_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720