FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632615_at:

>probe:Drosophila_2:1632615_at:472:51; Interrogation_Position=13; Antisense; ATGCGGTTTCACCTGTACGAAATGG
>probe:Drosophila_2:1632615_at:66:551; Interrogation_Position=132; Antisense; GGAGTTGATCAACACCCGGATGCAG
>probe:Drosophila_2:1632615_at:637:287; Interrogation_Position=182; Antisense; CGCGGTGGAACTATCGAAACGTCTT
>probe:Drosophila_2:1632615_at:7:171; Interrogation_Position=198; Antisense; AAACGTCTTCGATGGACTGTACCGT
>probe:Drosophila_2:1632615_at:675:119; Interrogation_Position=248; Antisense; AGCTGTACAGCGGATGTTTCCTCTC
>probe:Drosophila_2:1632615_at:396:185; Interrogation_Position=305; Antisense; AAAATGCTGCTTACGATCAGGCCAA
>probe:Drosophila_2:1632615_at:498:35; Interrogation_Position=320; Antisense; ATCAGGCCAAGCAGATCTACGCAGA
>probe:Drosophila_2:1632615_at:558:271; Interrogation_Position=371; Antisense; CATTGCTGCACCTGATAAGTTCCGT
>probe:Drosophila_2:1632615_at:427:225; Interrogation_Position=40; Antisense; AAGGAGCACCTGGATGATCCTGCTG
>probe:Drosophila_2:1632615_at:621:695; Interrogation_Position=405; Antisense; TTTCGTCTGCGGTCCAATCATCAAG
>probe:Drosophila_2:1632615_at:724:701; Interrogation_Position=522; Antisense; TTTTCGCGGTCTTCAGACATCTGAG
>probe:Drosophila_2:1632615_at:234:439; Interrogation_Position=544; Antisense; GAGGCACAACTCATCGTCGATGCAA
>probe:Drosophila_2:1632615_at:389:449; Interrogation_Position=55; Antisense; GATCCTGCTGGTTTGTTGGACAAAG
>probe:Drosophila_2:1632615_at:651:255; Interrogation_Position=75; Antisense; CAAAGTGCTGGTGGCTGCATTGGCT

Paste this into a BLAST search page for me
ATGCGGTTTCACCTGTACGAAATGGGGAGTTGATCAACACCCGGATGCAGCGCGGTGGAACTATCGAAACGTCTTAAACGTCTTCGATGGACTGTACCGTAGCTGTACAGCGGATGTTTCCTCTCAAAATGCTGCTTACGATCAGGCCAAATCAGGCCAAGCAGATCTACGCAGACATTGCTGCACCTGATAAGTTCCGTAAGGAGCACCTGGATGATCCTGCTGTTTCGTCTGCGGTCCAATCATCAAGTTTTCGCGGTCTTCAGACATCTGAGGAGGCACAACTCATCGTCGATGCAAGATCCTGCTGGTTTGTTGGACAAAGCAAAGTGCTGGTGGCTGCATTGGCT

Full Affymetrix probeset data:

Annotations for 1632615_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720