FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632616_at:

>probe:Drosophila_2:1632616_at:306:113; Interrogation_Position=412; Antisense; AGCAGCCACTGCCAATCGGAAATAT
>probe:Drosophila_2:1632616_at:506:663; Interrogation_Position=483; Antisense; TAAAGCTGCTTCTGGAACCGCACGA
>probe:Drosophila_2:1632616_at:251:259; Interrogation_Position=521; Antisense; CACTGGTTGAGTCCGATCGAGGCTT
>probe:Drosophila_2:1632616_at:617:293; Interrogation_Position=538; Antisense; CGAGGCTTGGTCGAGCTCACAGAAA
>probe:Drosophila_2:1632616_at:264:473; Interrogation_Position=580; Antisense; GTTCATGCTGCTCTATGACATCGCT
>probe:Drosophila_2:1632616_at:654:635; Interrogation_Position=600; Antisense; TCGCTCGTCTGATGAACTTCTATAG
>probe:Drosophila_2:1632616_at:690:277; Interrogation_Position=694; Antisense; CTATCGCTGCGATGACTGCATGTTT
>probe:Drosophila_2:1632616_at:575:93; Interrogation_Position=721; Antisense; AGTTCTTCCTGGTGATGAGCTCTAT
>probe:Drosophila_2:1632616_at:403:417; Interrogation_Position=737; Antisense; GAGCTCTATCCCAAAGAACCAGGCG
>probe:Drosophila_2:1632616_at:633:107; Interrogation_Position=751; Antisense; AGAACCAGGCGCTTGTACACAAACA
>probe:Drosophila_2:1632616_at:517:451; Interrogation_Position=789; Antisense; GATCGGTGGACGACCTTCATCGAAA
>probe:Drosophila_2:1632616_at:42:161; Interrogation_Position=852; Antisense; ACAAGGTCGTACTGGCCTCCAATAT
>probe:Drosophila_2:1632616_at:406:259; Interrogation_Position=900; Antisense; CACTGCAGCCTCTTGTCAATAACAA
>probe:Drosophila_2:1632616_at:481:687; Interrogation_Position=969; Antisense; TATATATTTCCTCTTGCGCTACAAC

Paste this into a BLAST search page for me
AGCAGCCACTGCCAATCGGAAATATTAAAGCTGCTTCTGGAACCGCACGACACTGGTTGAGTCCGATCGAGGCTTCGAGGCTTGGTCGAGCTCACAGAAAGTTCATGCTGCTCTATGACATCGCTTCGCTCGTCTGATGAACTTCTATAGCTATCGCTGCGATGACTGCATGTTTAGTTCTTCCTGGTGATGAGCTCTATGAGCTCTATCCCAAAGAACCAGGCGAGAACCAGGCGCTTGTACACAAACAGATCGGTGGACGACCTTCATCGAAAACAAGGTCGTACTGGCCTCCAATATCACTGCAGCCTCTTGTCAATAACAATATATATTTCCTCTTGCGCTACAAC

Full Affymetrix probeset data:

Annotations for 1632616_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720