Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632620_at:

>probe:Drosophila_2:1632620_at:166:321; Interrogation_Position=1743; Antisense; GCCCCACTTGATCATGACTACGATA
>probe:Drosophila_2:1632620_at:730:383; Interrogation_Position=1758; Antisense; GACTACGATAGTTCCATTTGGCGGC
>probe:Drosophila_2:1632620_at:16:21; Interrogation_Position=1773; Antisense; ATTTGGCGGCATGTTGGCGGATCAC
>probe:Drosophila_2:1632620_at:425:171; Interrogation_Position=1803; Antisense; AAAGAATGGTATCCTGTCCACCACC
>probe:Drosophila_2:1632620_at:713:127; Interrogation_Position=1825; Antisense; ACCAATGTGCGCAAGCTCTTCAATT
>probe:Drosophila_2:1632620_at:552:497; Interrogation_Position=1871; Antisense; GTCTGTTTTTCCTATTCGTGGCACA
>probe:Drosophila_2:1632620_at:720:323; Interrogation_Position=1906; Antisense; GCGACGGGTGCCATGTTTGCCTTGA
>probe:Drosophila_2:1632620_at:249:583; Interrogation_Position=1950; Antisense; TGGCTTTGCCATATCCGGTTATAAT
>probe:Drosophila_2:1632620_at:541:459; Interrogation_Position=1987; Antisense; GATATTGCTCCTCGTTATGCTAGTA
>probe:Drosophila_2:1632620_at:664:227; Interrogation_Position=2029; Antisense; AATGGAATTGGTACTCTGGCCGGCA
>probe:Drosophila_2:1632620_at:485:37; Interrogation_Position=2053; Antisense; ATCATTGTGCCCTATGCCCTTGATG
>probe:Drosophila_2:1632620_at:453:581; Interrogation_Position=2076; Antisense; TGGCCTCATCCAAGCTAATGGTGCC
>probe:Drosophila_2:1632620_at:414:235; Interrogation_Position=2251; Antisense; AATCCTGGGCAGTATGGCTACACGC
>probe:Drosophila_2:1632620_at:125:633; Interrogation_Position=2298; Antisense; TCCGCAGGGATACCAGCAGCAGTAA

Paste this into a BLAST search page for me
GCCCCACTTGATCATGACTACGATAGACTACGATAGTTCCATTTGGCGGCATTTGGCGGCATGTTGGCGGATCACAAAGAATGGTATCCTGTCCACCACCACCAATGTGCGCAAGCTCTTCAATTGTCTGTTTTTCCTATTCGTGGCACAGCGACGGGTGCCATGTTTGCCTTGATGGCTTTGCCATATCCGGTTATAATGATATTGCTCCTCGTTATGCTAGTAAATGGAATTGGTACTCTGGCCGGCAATCATTGTGCCCTATGCCCTTGATGTGGCCTCATCCAAGCTAATGGTGCCAATCCTGGGCAGTATGGCTACACGCTCCGCAGGGATACCAGCAGCAGTAA

Full Affymetrix probeset data:

Annotations for 1632620_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime