FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632621_at:

>probe:Drosophila_2:1632621_at:6:157; Interrogation_Position=1256; Antisense; ACAGCGGCATCCGTTGGTGTTCCAC
>probe:Drosophila_2:1632621_at:217:127; Interrogation_Position=1324; Antisense; ACCAATGCCAGTTTTTGGCGCGGGA
>probe:Drosophila_2:1632621_at:53:33; Interrogation_Position=1375; Antisense; ATCAAGTGGCATGGCCGGCGTTCCA
>probe:Drosophila_2:1632621_at:20:447; Interrogation_Position=1411; Antisense; GATGCAGAAATCACAGCCCAAGGCT
>probe:Drosophila_2:1632621_at:119:623; Interrogation_Position=1471; Antisense; TGCGTTCTTGGAGAGCATTCGACAA
>probe:Drosophila_2:1632621_at:436:221; Interrogation_Position=1537; Antisense; AAGTGGCATTAAGCCGCGTCCAGAA
>probe:Drosophila_2:1632621_at:422:503; Interrogation_Position=1554; Antisense; GTCCAGAACGTAAGCCGGTGACCAC
>probe:Drosophila_2:1632621_at:501:533; Interrogation_Position=1570; Antisense; GGTGACCACCGACTTTCTAAGTGAA
>probe:Drosophila_2:1632621_at:168:545; Interrogation_Position=1636; Antisense; GGATAATCCGTATTCCGAGGAATCG
>probe:Drosophila_2:1632621_at:456:293; Interrogation_Position=1665; Antisense; CGCAGGCGTAACGATTTGGCGGTTA
>probe:Drosophila_2:1632621_at:492:709; Interrogation_Position=1687; Antisense; TTAAACTTTCAACTGCGCCGCATTT
>probe:Drosophila_2:1632621_at:632:297; Interrogation_Position=1705; Antisense; CGCATTTTACCACACTGAACCAAGT
>probe:Drosophila_2:1632621_at:456:569; Interrogation_Position=1730; Antisense; GGCAGGGCTGCCAGACTGAGAACAA
>probe:Drosophila_2:1632621_at:250:403; Interrogation_Position=1743; Antisense; GACTGAGAACAACCGCCTTAATTTT

Paste this into a BLAST search page for me
ACAGCGGCATCCGTTGGTGTTCCACACCAATGCCAGTTTTTGGCGCGGGAATCAAGTGGCATGGCCGGCGTTCCAGATGCAGAAATCACAGCCCAAGGCTTGCGTTCTTGGAGAGCATTCGACAAAAGTGGCATTAAGCCGCGTCCAGAAGTCCAGAACGTAAGCCGGTGACCACGGTGACCACCGACTTTCTAAGTGAAGGATAATCCGTATTCCGAGGAATCGCGCAGGCGTAACGATTTGGCGGTTATTAAACTTTCAACTGCGCCGCATTTCGCATTTTACCACACTGAACCAAGTGGCAGGGCTGCCAGACTGAGAACAAGACTGAGAACAACCGCCTTAATTTT

Full Affymetrix probeset data:

Annotations for 1632621_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720