FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632622_at:

>probe:Drosophila_2:1632622_at:85:703; Interrogation_Position=1647; Antisense; TTATTGGTTACCTTGCATATTGCGC
>probe:Drosophila_2:1632622_at:371:719; Interrogation_Position=1666; Antisense; TTGCGCATGCAAAGACCCGGACAGG
>probe:Drosophila_2:1632622_at:185:401; Interrogation_Position=1685; Antisense; GACAGGTTGGCTACGAATGTCCGCC
>probe:Drosophila_2:1632622_at:241:77; Interrogation_Position=1778; Antisense; AGGAGAGATCCTCCAAGTCTCTGCT
>probe:Drosophila_2:1632622_at:229:333; Interrogation_Position=1800; Antisense; GCTGGCCAATGTGCTCGATATAGAC
>probe:Drosophila_2:1632622_at:314:239; Interrogation_Position=1840; Antisense; AATCATCGATGTGCCAGCGCGACTT
>probe:Drosophila_2:1632622_at:565:137; Interrogation_Position=1955; Antisense; ACGGGCGTTTGCACGAGGCCATTTC
>probe:Drosophila_2:1632622_at:97:643; Interrogation_Position=1989; Antisense; TCTGACATCCTCTGCGGAGTACGAA
>probe:Drosophila_2:1632622_at:501:671; Interrogation_Position=2008; Antisense; TACGAACTGGCGCTGATACTCAAGG
>probe:Drosophila_2:1632622_at:662:395; Interrogation_Position=2097; Antisense; GAAATTTGCTGCCATGGTCGTCGAT
>probe:Drosophila_2:1632622_at:69:501; Interrogation_Position=2113; Antisense; GTCGTCGATCGTTTGTGCCTTATTA
>probe:Drosophila_2:1632622_at:558:627; Interrogation_Position=2128; Antisense; TGCCTTATTATTTTCACCTTGTTTA
>probe:Drosophila_2:1632622_at:521:147; Interrogation_Position=2152; Antisense; ACTATTATAGCAACCCTCGCTGTAC
>probe:Drosophila_2:1632622_at:528:649; Interrogation_Position=2182; Antisense; TCAGCGCCGCATTTCATTGTGAGTG

Paste this into a BLAST search page for me
TTATTGGTTACCTTGCATATTGCGCTTGCGCATGCAAAGACCCGGACAGGGACAGGTTGGCTACGAATGTCCGCCAGGAGAGATCCTCCAAGTCTCTGCTGCTGGCCAATGTGCTCGATATAGACAATCATCGATGTGCCAGCGCGACTTACGGGCGTTTGCACGAGGCCATTTCTCTGACATCCTCTGCGGAGTACGAATACGAACTGGCGCTGATACTCAAGGGAAATTTGCTGCCATGGTCGTCGATGTCGTCGATCGTTTGTGCCTTATTATGCCTTATTATTTTCACCTTGTTTAACTATTATAGCAACCCTCGCTGTACTCAGCGCCGCATTTCATTGTGAGTG

Full Affymetrix probeset data:

Annotations for 1632622_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720