FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632623_at:

>probe:Drosophila_2:1632623_at:238:327; Interrogation_Position=1026; Antisense; GCGATGACGTCGATAGCCAGCTTTA
>probe:Drosophila_2:1632623_at:609:673; Interrogation_Position=1039; Antisense; TAGCCAGCTTTAGCTTCTGCTTGAT
>probe:Drosophila_2:1632623_at:223:343; Interrogation_Position=1057; Antisense; GCTTGATTGGTCTGAATGCGGCGCA
>probe:Drosophila_2:1632623_at:18:53; Interrogation_Position=1072; Antisense; ATGCGGCGCATCACGATCCGGAAAT
>probe:Drosophila_2:1632623_at:441:45; Interrogation_Position=1087; Antisense; ATCCGGAAATCTATCACGAGGGTGA
>probe:Drosophila_2:1632623_at:241:447; Interrogation_Position=1110; Antisense; GATGCCAATCGTGAGGATCGTGACT
>probe:Drosophila_2:1632623_at:22:399; Interrogation_Position=1152; Antisense; GACACGATTATCGACCGCGGTGATC
>probe:Drosophila_2:1632623_at:101:291; Interrogation_Position=1169; Antisense; CGGTGATCTCAAGTGGTCGCAGTTC
>probe:Drosophila_2:1632623_at:69:509; Interrogation_Position=1278; Antisense; GTGCTTTACCAGACTCTCGATGAGT
>probe:Drosophila_2:1632623_at:659:57; Interrogation_Position=1297; Antisense; ATGAGTTCAAGGGTCATCTCCGCGA
>probe:Drosophila_2:1632623_at:466:43; Interrogation_Position=1332; Antisense; ATCGAGCACATGATTGGCCAGCACA
>probe:Drosophila_2:1632623_at:579:359; Interrogation_Position=1358; Antisense; GCAACTATTGCGCATCGAGCCCAAT
>probe:Drosophila_2:1632623_at:302:229; Interrogation_Position=884; Antisense; AATGGGCACTCGTATTTTCTATTCG
>probe:Drosophila_2:1632623_at:642:679; Interrogation_Position=994; Antisense; TAGGCATTTGGATCTGCGTGCGCCA

Paste this into a BLAST search page for me
GCGATGACGTCGATAGCCAGCTTTATAGCCAGCTTTAGCTTCTGCTTGATGCTTGATTGGTCTGAATGCGGCGCAATGCGGCGCATCACGATCCGGAAATATCCGGAAATCTATCACGAGGGTGAGATGCCAATCGTGAGGATCGTGACTGACACGATTATCGACCGCGGTGATCCGGTGATCTCAAGTGGTCGCAGTTCGTGCTTTACCAGACTCTCGATGAGTATGAGTTCAAGGGTCATCTCCGCGAATCGAGCACATGATTGGCCAGCACAGCAACTATTGCGCATCGAGCCCAATAATGGGCACTCGTATTTTCTATTCGTAGGCATTTGGATCTGCGTGCGCCA

Full Affymetrix probeset data:

Annotations for 1632623_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720