Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632624_at:

>probe:Drosophila_2:1632624_at:164:459; Interrogation_Position=1124; Antisense; GATTTAGCCGTTGCGGAGCGAAGCC
>probe:Drosophila_2:1632624_at:257:501; Interrogation_Position=1153; Antisense; GTCGATCTTCATATTCAACATCCCG
>probe:Drosophila_2:1632624_at:622:249; Interrogation_Position=1184; Antisense; CAATTTGTGGCTTCGTACAGGCGCA
>probe:Drosophila_2:1632624_at:695:239; Interrogation_Position=1249; Antisense; AATCACGGGCGAGTTGCTGGTCAAC
>probe:Drosophila_2:1632624_at:192:333; Interrogation_Position=1264; Antisense; GCTGGTCAACGTTATTCGGCGTGAT
>probe:Drosophila_2:1632624_at:494:447; Interrogation_Position=1289; Antisense; GATGCGGACCTTGCAGTGTGCGAAA
>probe:Drosophila_2:1632624_at:440:395; Interrogation_Position=1310; Antisense; GAAATTCTGGTCTTGGCCTCCTTAA
>probe:Drosophila_2:1632624_at:122:175; Interrogation_Position=1333; Antisense; AAACCGCGTGGTTGACTTGATGTCC
>probe:Drosophila_2:1632624_at:556:723; Interrogation_Position=1349; Antisense; TTGATGTCCCATCAGGATCGCGGCA
>probe:Drosophila_2:1632624_at:676:197; Interrogation_Position=1402; Antisense; AACGAAAATTGCCACCGGCGGACTG
>probe:Drosophila_2:1632624_at:184:587; Interrogation_Position=1425; Antisense; TGGACGACACCTTTTCGCTGTGGAA
>probe:Drosophila_2:1632624_at:699:593; Interrogation_Position=1443; Antisense; TGTGGAACTTCTTTCCCACCTATAA
>probe:Drosophila_2:1632624_at:417:251; Interrogation_Position=1504; Antisense; CAAGGACAAGTGCAGCTCCCTGAGC
>probe:Drosophila_2:1632624_at:269:567; Interrogation_Position=1688; Antisense; GGCCTCTCCACCCAAAGTGAAGGTA

Paste this into a BLAST search page for me
GATTTAGCCGTTGCGGAGCGAAGCCGTCGATCTTCATATTCAACATCCCGCAATTTGTGGCTTCGTACAGGCGCAAATCACGGGCGAGTTGCTGGTCAACGCTGGTCAACGTTATTCGGCGTGATGATGCGGACCTTGCAGTGTGCGAAAGAAATTCTGGTCTTGGCCTCCTTAAAAACCGCGTGGTTGACTTGATGTCCTTGATGTCCCATCAGGATCGCGGCAAACGAAAATTGCCACCGGCGGACTGTGGACGACACCTTTTCGCTGTGGAATGTGGAACTTCTTTCCCACCTATAACAAGGACAAGTGCAGCTCCCTGAGCGGCCTCTCCACCCAAAGTGAAGGTA

Full Affymetrix probeset data:

Annotations for 1632624_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime