Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632625_a_at:

>probe:Drosophila_2:1632625_a_at:301:179; Interrogation_Position=500; Antisense; AAACATCTGTTTGCCACCAACCTGA
>probe:Drosophila_2:1632625_a_at:133:607; Interrogation_Position=546; Antisense; TGATGCGCAAGTGCCTGCAGCTCTT
>probe:Drosophila_2:1632625_a_at:12:645; Interrogation_Position=567; Antisense; TCTTCTGCATCATCGAGAACCGCGC
>probe:Drosophila_2:1632625_a_at:87:95; Interrogation_Position=627; Antisense; AGTTGCCGGAAAGGGAGATCCTCCA
>probe:Drosophila_2:1632625_a_at:439:129; Interrogation_Position=693; Antisense; ACCAGAGCATGCACGGCTTCGGCTA
>probe:Drosophila_2:1632625_a_at:336:327; Interrogation_Position=720; Antisense; GCGAGGGTCACTACCAGATCTTTGT
>probe:Drosophila_2:1632625_a_at:585:659; Interrogation_Position=784; Antisense; TAACGCGGCCACTGCTGAAGTCAAG
>probe:Drosophila_2:1632625_a_at:666:247; Interrogation_Position=817; Antisense; CAATTAGTTAGTTGCCCGCGACCAA
>probe:Drosophila_2:1632625_a_at:132:527; Interrogation_Position=843; Antisense; GGGAACCACTGACATCCCAGCATGT
>probe:Drosophila_2:1632625_a_at:466:397; Interrogation_Position=872; Antisense; GACAATGTGCCAATTGAGCCCAGCA
>probe:Drosophila_2:1632625_a_at:53:203; Interrogation_Position=903; Antisense; AATCAAACCCAATCCACAAATATCC
>probe:Drosophila_2:1632625_a_at:683:163; Interrogation_Position=920; Antisense; AAATATCCCTCTACATCCAAGTCTT
>probe:Drosophila_2:1632625_a_at:382:49; Interrogation_Position=934; Antisense; ATCCAAGTCTTCTTCAATAGTCTAA
>probe:Drosophila_2:1632625_a_at:284:601; Interrogation_Position=995; Antisense; TGTACAGTCATCAAAGCGCATTATT

Paste this into a BLAST search page for me
AAACATCTGTTTGCCACCAACCTGATGATGCGCAAGTGCCTGCAGCTCTTTCTTCTGCATCATCGAGAACCGCGCAGTTGCCGGAAAGGGAGATCCTCCAACCAGAGCATGCACGGCTTCGGCTAGCGAGGGTCACTACCAGATCTTTGTTAACGCGGCCACTGCTGAAGTCAAGCAATTAGTTAGTTGCCCGCGACCAAGGGAACCACTGACATCCCAGCATGTGACAATGTGCCAATTGAGCCCAGCAAATCAAACCCAATCCACAAATATCCAAATATCCCTCTACATCCAAGTCTTATCCAAGTCTTCTTCAATAGTCTAATGTACAGTCATCAAAGCGCATTATT

Full Affymetrix probeset data:

Annotations for 1632625_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime