FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632626_at:

>probe:Drosophila_2:1632626_at:380:405; Interrogation_Position=1023; Antisense; GACTCTGCAAGATGGTGGGCGCTCT
>probe:Drosophila_2:1632626_at:392:379; Interrogation_Position=1052; Antisense; GAAGCCTTCGGCAGCAAGGAGTCCT
>probe:Drosophila_2:1632626_at:200:591; Interrogation_Position=1079; Antisense; TGGGTTAAGGCTCCAGTTTCCACAG
>probe:Drosophila_2:1632626_at:202:667; Interrogation_Position=1112; Antisense; TTTGAGGACGGCCTCTACGTTCAGG
>probe:Drosophila_2:1632626_at:2:539; Interrogation_Position=1141; Antisense; GGTTGAGGCCATCCGGAAATCGAAC
>probe:Drosophila_2:1632626_at:237:567; Interrogation_Position=1179; Antisense; GGCAAAGGGTTCAGCTGTCCACCGA
>probe:Drosophila_2:1632626_at:524:457; Interrogation_Position=1233; Antisense; GATATGCACGCATGTCCACAATGTG
>probe:Drosophila_2:1632626_at:297:171; Interrogation_Position=1346; Antisense; AAAGATTCAGGCTTTCCAGCCGGCG
>probe:Drosophila_2:1632626_at:124:489; Interrogation_Position=1400; Antisense; GTACGGCATCAGCATTTTGCAACTA
>probe:Drosophila_2:1632626_at:9:175; Interrogation_Position=848; Antisense; AAAGCCTTCTCGCAGGAAGTGCTCA
>probe:Drosophila_2:1632626_at:425:563; Interrogation_Position=862; Antisense; GGAAGTGCTCATCTATGGCAGCAAA
>probe:Drosophila_2:1632626_at:667:527; Interrogation_Position=908; Antisense; GGCGACCTATTTGTCCTCAAGGAGG
>probe:Drosophila_2:1632626_at:54:549; Interrogation_Position=961; Antisense; GGATGTCCAGGATTTGCACTTCGCC
>probe:Drosophila_2:1632626_at:692:643; Interrogation_Position=995; Antisense; TCTTTGCTACCACGACCATATATCA

Paste this into a BLAST search page for me
GACTCTGCAAGATGGTGGGCGCTCTGAAGCCTTCGGCAGCAAGGAGTCCTTGGGTTAAGGCTCCAGTTTCCACAGTTTGAGGACGGCCTCTACGTTCAGGGGTTGAGGCCATCCGGAAATCGAACGGCAAAGGGTTCAGCTGTCCACCGAGATATGCACGCATGTCCACAATGTGAAAGATTCAGGCTTTCCAGCCGGCGGTACGGCATCAGCATTTTGCAACTAAAAGCCTTCTCGCAGGAAGTGCTCAGGAAGTGCTCATCTATGGCAGCAAAGGCGACCTATTTGTCCTCAAGGAGGGGATGTCCAGGATTTGCACTTCGCCTCTTTGCTACCACGACCATATATCA

Full Affymetrix probeset data:

Annotations for 1632626_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720