Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632627_at:

>probe:Drosophila_2:1632627_at:113:561; Interrogation_Position=2454; Antisense; GGAAATGTTGCCGATTCTGGAGAAA
>probe:Drosophila_2:1632627_at:348:217; Interrogation_Position=2588; Antisense; AAGTTTCCGGCGAAAGCTGCCATAT
>probe:Drosophila_2:1632627_at:720:335; Interrogation_Position=2603; Antisense; GCTGCCATATGGATCGCACAGATTT
>probe:Drosophila_2:1632627_at:45:21; Interrogation_Position=2659; Antisense; ATTTGGGCAGCCTACATTGCCAAAC
>probe:Drosophila_2:1632627_at:427:153; Interrogation_Position=2698; Antisense; ACAGAGATTCTGTTGGCCCAAGTAC
>probe:Drosophila_2:1632627_at:134:229; Interrogation_Position=2736; Antisense; AATGGAGCAGCTGGCCAGAAAACGT
>probe:Drosophila_2:1632627_at:163:553; Interrogation_Position=2787; Antisense; GGAGCAGCGGCTTCACAAGAAAAGA
>probe:Drosophila_2:1632627_at:619:513; Interrogation_Position=2822; Antisense; GTGATCTATTTCGAGCTCCAAGGCG
>probe:Drosophila_2:1632627_at:162:381; Interrogation_Position=2846; Antisense; GAACGAACCGCGAGCGACAAGCCAT
>probe:Drosophila_2:1632627_at:583:559; Interrogation_Position=2894; Antisense; GGAAATCTAAATGCTCGCTAACGTC
>probe:Drosophila_2:1632627_at:726:339; Interrogation_Position=2910; Antisense; GCTAACGTCATTTTGTTGCCGACAG
>probe:Drosophila_2:1632627_at:673:267; Interrogation_Position=2940; Antisense; CAGGTGCGGCTTGATCTGGACACAT
>probe:Drosophila_2:1632627_at:238:657; Interrogation_Position=2964; Antisense; TAAGTGCTCCGAAGGATCCGACGAT
>probe:Drosophila_2:1632627_at:21:547; Interrogation_Position=2977; Antisense; GGATCCGACGATACTTCAGCAGAAC

Paste this into a BLAST search page for me
GGAAATGTTGCCGATTCTGGAGAAAAAGTTTCCGGCGAAAGCTGCCATATGCTGCCATATGGATCGCACAGATTTATTTGGGCAGCCTACATTGCCAAACACAGAGATTCTGTTGGCCCAAGTACAATGGAGCAGCTGGCCAGAAAACGTGGAGCAGCGGCTTCACAAGAAAAGAGTGATCTATTTCGAGCTCCAAGGCGGAACGAACCGCGAGCGACAAGCCATGGAAATCTAAATGCTCGCTAACGTCGCTAACGTCATTTTGTTGCCGACAGCAGGTGCGGCTTGATCTGGACACATTAAGTGCTCCGAAGGATCCGACGATGGATCCGACGATACTTCAGCAGAAC

Full Affymetrix probeset data:

Annotations for 1632627_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime