FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632630_at:

>probe:Drosophila_2:1632630_at:38:381; Interrogation_Position=1036; Antisense; GAACGCAATGCTTATTAGCCAATTA
>probe:Drosophila_2:1632630_at:166:471; Interrogation_Position=1109; Antisense; GTACTTTGTTCTGTTAATAACCCAG
>probe:Drosophila_2:1632630_at:513:427; Interrogation_Position=594; Antisense; GAGATCAAGCCAGTTTTCCAGCAGG
>probe:Drosophila_2:1632630_at:469:629; Interrogation_Position=610; Antisense; TCCAGCAGGCGGGTGCTTTAATCGG
>probe:Drosophila_2:1632630_at:715:653; Interrogation_Position=628; Antisense; TAATCGGGCGGCGAGATTGCCTCAC
>probe:Drosophila_2:1632630_at:92:589; Interrogation_Position=709; Antisense; TGGAGGCCATCAAACGACATGCGGT
>probe:Drosophila_2:1632630_at:321:319; Interrogation_Position=740; Antisense; GCCGCCGCGGGAAAACGATTAGAAG
>probe:Drosophila_2:1632630_at:604:263; Interrogation_Position=771; Antisense; CAGAAGACATCTGGGCCTGGTAGTC
>probe:Drosophila_2:1632630_at:457:301; Interrogation_Position=798; Antisense; CCCTCCACTGGCTTTAATTAGACAT
>probe:Drosophila_2:1632630_at:421:523; Interrogation_Position=840; Antisense; GGGCTTAGGATAACGCTTATTTGTA
>probe:Drosophila_2:1632630_at:576:245; Interrogation_Position=864; Antisense; AATTAGCCAGACGAGATTGCGAGAT
>probe:Drosophila_2:1632630_at:349:447; Interrogation_Position=901; Antisense; GATGCGTTGTCATTATTTGCAAAGA
>probe:Drosophila_2:1632630_at:723:691; Interrogation_Position=928; Antisense; TTTCTTTTCGGTTAACTACTGCTGA
>probe:Drosophila_2:1632630_at:506:511; Interrogation_Position=982; Antisense; GTGAGACTTCTGCATAGGACAACGA

Paste this into a BLAST search page for me
GAACGCAATGCTTATTAGCCAATTAGTACTTTGTTCTGTTAATAACCCAGGAGATCAAGCCAGTTTTCCAGCAGGTCCAGCAGGCGGGTGCTTTAATCGGTAATCGGGCGGCGAGATTGCCTCACTGGAGGCCATCAAACGACATGCGGTGCCGCCGCGGGAAAACGATTAGAAGCAGAAGACATCTGGGCCTGGTAGTCCCCTCCACTGGCTTTAATTAGACATGGGCTTAGGATAACGCTTATTTGTAAATTAGCCAGACGAGATTGCGAGATGATGCGTTGTCATTATTTGCAAAGATTTCTTTTCGGTTAACTACTGCTGAGTGAGACTTCTGCATAGGACAACGA

Full Affymetrix probeset data:

Annotations for 1632630_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720