FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632632_at:

>probe:Drosophila_2:1632632_at:468:559; Interrogation_Position=195; Antisense; GGACAAGAACCCACAAAGCAGCATT
>probe:Drosophila_2:1632632_at:545:351; Interrogation_Position=289; Antisense; GCAGACACCGTGAACGCCAAGGATA
>probe:Drosophila_2:1632632_at:727:543; Interrogation_Position=309; Antisense; GGATAACGACGGATACACGCCGCTG
>probe:Drosophila_2:1632632_at:348:355; Interrogation_Position=333; Antisense; GCACCGAGCTGCCTATAATAACTTT
>probe:Drosophila_2:1632632_at:119:217; Interrogation_Position=370; Antisense; AAGTTGCTGCTGCAGTACCATGCCA
>probe:Drosophila_2:1632632_at:146:417; Interrogation_Position=412; Antisense; GAGCTGGGATGGACGCCATTGCACT
>probe:Drosophila_2:1632632_at:369:559; Interrogation_Position=449; Antisense; GGAACAATGCGGATTGCGCCCATTT
>probe:Drosophila_2:1632632_at:111:285; Interrogation_Position=475; Antisense; CTGCTGCAGTTTGGCGCCGATGTAA
>probe:Drosophila_2:1632632_at:459:31; Interrogation_Position=535; Antisense; ATAACCGCCACTGTGTCCAATTGTC
>probe:Drosophila_2:1632632_at:401:247; Interrogation_Position=552; Antisense; CAATTGTCGGAATACGGCCACGGTC
>probe:Drosophila_2:1632632_at:322:423; Interrogation_Position=610; Antisense; GAGAACAACTCCGAGGAACTGGCCT
>probe:Drosophila_2:1632632_at:415:511; Interrogation_Position=637; Antisense; GTGATTGCCCGTCGTACTGGCATGA
>probe:Drosophila_2:1632632_at:685:1; Interrogation_Position=658; Antisense; ATGAGTTTTCCCATTTTCGAGTCCG
>probe:Drosophila_2:1632632_at:667:375; Interrogation_Position=688; Antisense; GAAGCCTACGACTGCGAAACGGGAC

Paste this into a BLAST search page for me
GGACAAGAACCCACAAAGCAGCATTGCAGACACCGTGAACGCCAAGGATAGGATAACGACGGATACACGCCGCTGGCACCGAGCTGCCTATAATAACTTTAAGTTGCTGCTGCAGTACCATGCCAGAGCTGGGATGGACGCCATTGCACTGGAACAATGCGGATTGCGCCCATTTCTGCTGCAGTTTGGCGCCGATGTAAATAACCGCCACTGTGTCCAATTGTCCAATTGTCGGAATACGGCCACGGTCGAGAACAACTCCGAGGAACTGGCCTGTGATTGCCCGTCGTACTGGCATGAATGAGTTTTCCCATTTTCGAGTCCGGAAGCCTACGACTGCGAAACGGGAC

Full Affymetrix probeset data:

Annotations for 1632632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720