FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632633_at:

>probe:Drosophila_2:1632633_at:534:557; Interrogation_Position=124; Antisense; GGACATCATGCGCAAGGCATTCCAA
>probe:Drosophila_2:1632633_at:226:571; Interrogation_Position=139; Antisense; GGCATTCCAAATGTTCGACACACAA
>probe:Drosophila_2:1632633_at:649:103; Interrogation_Position=165; Antisense; AGACGGGCTTCATTGAGACGCTGCG
>probe:Drosophila_2:1632633_at:685:137; Interrogation_Position=197; Antisense; ACGATCCTCAACAGCATGGGTCAGA
>probe:Drosophila_2:1632633_at:510:675; Interrogation_Position=232; Antisense; TAGCGAACTGCAGGCTCTGATCGAC
>probe:Drosophila_2:1632633_at:301:223; Interrogation_Position=281; Antisense; AAGGTTAACTTCGACGGCTTCTGCA
>probe:Drosophila_2:1632633_at:290:45; Interrogation_Position=308; Antisense; ATCGCTGCCCATTTCCTGGAAGAGG
>probe:Drosophila_2:1632633_at:339:387; Interrogation_Position=361; Antisense; GAAAGAGGCCTTTCGTCTGTACGAT
>probe:Drosophila_2:1632633_at:39:395; Interrogation_Position=393; Antisense; GAAATGGTTACATCACCACCTCAAC
>probe:Drosophila_2:1632633_at:447:199; Interrogation_Position=415; Antisense; AACGCTGAAGGAAATTCTCGCCGCC
>probe:Drosophila_2:1632633_at:667:451; Interrogation_Position=464; Antisense; GATCTGGACGGCATCATCGCTGAGA
>probe:Drosophila_2:1632633_at:328:725; Interrogation_Position=489; Antisense; TTGACACTGATGGATCCGGTACCGT
>probe:Drosophila_2:1632633_at:435:537; Interrogation_Position=506; Antisense; GGTACCGTGGACTTTGATGAATTCA
>probe:Drosophila_2:1632633_at:483:297; Interrogation_Position=69; Antisense; CGCTCGCAAATTGTCGTTTGGCCAA

Paste this into a BLAST search page for me
GGACATCATGCGCAAGGCATTCCAAGGCATTCCAAATGTTCGACACACAAAGACGGGCTTCATTGAGACGCTGCGACGATCCTCAACAGCATGGGTCAGATAGCGAACTGCAGGCTCTGATCGACAAGGTTAACTTCGACGGCTTCTGCAATCGCTGCCCATTTCCTGGAAGAGGGAAAGAGGCCTTTCGTCTGTACGATGAAATGGTTACATCACCACCTCAACAACGCTGAAGGAAATTCTCGCCGCCGATCTGGACGGCATCATCGCTGAGATTGACACTGATGGATCCGGTACCGTGGTACCGTGGACTTTGATGAATTCACGCTCGCAAATTGTCGTTTGGCCAA

Full Affymetrix probeset data:

Annotations for 1632633_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720