FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632634_at:

>probe:Drosophila_2:1632634_at:675:437; Interrogation_Position=1215; Antisense; GAGGACACGTTCACTGAGTACACAC
>probe:Drosophila_2:1632634_at:493:283; Interrogation_Position=1254; Antisense; CTGCTTAAGCATGAGTTCCCCTATA
>probe:Drosophila_2:1632634_at:193:657; Interrogation_Position=1277; Antisense; TAAGGAACCGCTGGTCAACTTCTTG
>probe:Drosophila_2:1632634_at:187:653; Interrogation_Position=1291; Antisense; TCAACTTCTTGTACTTCCTATTCCG
>probe:Drosophila_2:1632634_at:17:289; Interrogation_Position=1346; Antisense; TCGGGCCTTACGCAAGCTTTACGAT
>probe:Drosophila_2:1632634_at:107:699; Interrogation_Position=1363; Antisense; TTTACGATCCATCCCTAAAGCGCGA
>probe:Drosophila_2:1632634_at:63:173; Interrogation_Position=1379; Antisense; AAAGCGCGACACGTCTTTTCTAAAG
>probe:Drosophila_2:1632634_at:347:687; Interrogation_Position=1428; Antisense; TATTTCGACGAGCATCCGGAGGCTG
>probe:Drosophila_2:1632634_at:119:403; Interrogation_Position=1491; Antisense; GACATATTCAATCGCCTTATGGCGG
>probe:Drosophila_2:1632634_at:72:445; Interrogation_Position=1530; Antisense; GATGCGGACGATCATGACACGACCC
>probe:Drosophila_2:1632634_at:226:51; Interrogation_Position=1543; Antisense; ATGACACGACCCTGAGGCGGCAAAA
>probe:Drosophila_2:1632634_at:702:213; Interrogation_Position=1616; Antisense; AAGAGGGATCCTTTGTTGCTGGTCT
>probe:Drosophila_2:1632634_at:679:723; Interrogation_Position=1631; Antisense; TTGCTGGTCTTTTTGGTTGCTCAAA
>probe:Drosophila_2:1632634_at:184:473; Interrogation_Position=1665; Antisense; GTTCTTTGCCACAAAATCATCGGGC

Paste this into a BLAST search page for me
GAGGACACGTTCACTGAGTACACACCTGCTTAAGCATGAGTTCCCCTATATAAGGAACCGCTGGTCAACTTCTTGTCAACTTCTTGTACTTCCTATTCCGTCGGGCCTTACGCAAGCTTTACGATTTTACGATCCATCCCTAAAGCGCGAAAAGCGCGACACGTCTTTTCTAAAGTATTTCGACGAGCATCCGGAGGCTGGACATATTCAATCGCCTTATGGCGGGATGCGGACGATCATGACACGACCCATGACACGACCCTGAGGCGGCAAAAAAGAGGGATCCTTTGTTGCTGGTCTTTGCTGGTCTTTTTGGTTGCTCAAAGTTCTTTGCCACAAAATCATCGGGC

Full Affymetrix probeset data:

Annotations for 1632634_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720