Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632636_at:

>probe:Drosophila_2:1632636_at:326:547; Interrogation_Position=1503; Antisense; GGAGTCGTCAGTCCCGATCCAAAGA
>probe:Drosophila_2:1632636_at:726:89; Interrogation_Position=1564; Antisense; AGTACTCGCGCGGTCAGGGCAAGAT
>probe:Drosophila_2:1632636_at:169:421; Interrogation_Position=1605; Antisense; GAGCACGTCTTTGTCTACGAGGTGA
>probe:Drosophila_2:1632636_at:89:371; Interrogation_Position=1628; Antisense; GAAGGACGGCACCATTATCGGATTC
>probe:Drosophila_2:1632636_at:717:669; Interrogation_Position=1643; Antisense; TATCGGATTCCACAACTGGGTCTAT
>probe:Drosophila_2:1632636_at:456:225; Interrogation_Position=1683; Antisense; AAGGACGGTCGCTTTGACTACAAGG
>probe:Drosophila_2:1632636_at:638:661; Interrogation_Position=1750; Antisense; TAAAGATCCGTTTCTCGCATCAGGG
>probe:Drosophila_2:1632636_at:512:241; Interrogation_Position=1791; Antisense; AATACTGTGTTTGTGGGCACCTCTC
>probe:Drosophila_2:1632636_at:152:505; Interrogation_Position=1873; Antisense; GTCCAGTGTCCTTGGGCAATAGCAA
>probe:Drosophila_2:1632636_at:637:109; Interrogation_Position=1893; Antisense; AGCAAGTTCGGCATTGTCACCTATT
>probe:Drosophila_2:1632636_at:461:393; Interrogation_Position=1933; Antisense; GAAAGAACCTCATTGGCAGCGCCTA
>probe:Drosophila_2:1632636_at:177:585; Interrogation_Position=1946; Antisense; TGGCAGCGCCTATCCGGAGATTTGA
>probe:Drosophila_2:1632636_at:466:327; Interrogation_Position=1975; Antisense; GCGATTAACGTTTGTGCCTCTCGTA
>probe:Drosophila_2:1632636_at:106:507; Interrogation_Position=1988; Antisense; GTGCCTCTCGTAGTCATCGTAGAAT

Paste this into a BLAST search page for me
GGAGTCGTCAGTCCCGATCCAAAGAAGTACTCGCGCGGTCAGGGCAAGATGAGCACGTCTTTGTCTACGAGGTGAGAAGGACGGCACCATTATCGGATTCTATCGGATTCCACAACTGGGTCTATAAGGACGGTCGCTTTGACTACAAGGTAAAGATCCGTTTCTCGCATCAGGGAATACTGTGTTTGTGGGCACCTCTCGTCCAGTGTCCTTGGGCAATAGCAAAGCAAGTTCGGCATTGTCACCTATTGAAAGAACCTCATTGGCAGCGCCTATGGCAGCGCCTATCCGGAGATTTGAGCGATTAACGTTTGTGCCTCTCGTAGTGCCTCTCGTAGTCATCGTAGAAT

Full Affymetrix probeset data:

Annotations for 1632636_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime