Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632637_at:

>probe:Drosophila_2:1632637_at:85:495; Interrogation_Position=15532; Antisense; GTCAACATGACCCAGCTGGCAATGG
>probe:Drosophila_2:1632637_at:143:293; Interrogation_Position=15559; Antisense; CGATATGCCTATTATGTGTGCTTTA
>probe:Drosophila_2:1632637_at:373:99; Interrogation_Position=15695; Antisense; AGATGTGTCCGAAGCATGGCACCGA
>probe:Drosophila_2:1632637_at:134:349; Interrogation_Position=15708; Antisense; GCATGGCACCGATTTCTTGGAGTAC
>probe:Drosophila_2:1632637_at:455:727; Interrogation_Position=15724; Antisense; TTGGAGTACAAGTGCCGCTACTGCT
>probe:Drosophila_2:1632637_at:729:667; Interrogation_Position=15742; Antisense; TACTGCTGCTCGGTGGCGGTATTCT
>probe:Drosophila_2:1632637_at:318:539; Interrogation_Position=15759; Antisense; GGTATTCTTCTGCTTTGGAACCACA
>probe:Drosophila_2:1632637_at:591:725; Interrogation_Position=15773; Antisense; TTGGAACCACACACTTCTGTGACAC
>probe:Drosophila_2:1632637_at:364:679; Interrogation_Position=15828; Antisense; TATACCCAAGGTCAAGTTGCCCCAG
>probe:Drosophila_2:1632637_at:114:369; Interrogation_Position=15892; Antisense; GAATGTCCGCTGCACGTAATGCATC
>probe:Drosophila_2:1632637_at:592:49; Interrogation_Position=15962; Antisense; ATGCCCAAACATTTTAGCCACACAC
>probe:Drosophila_2:1632637_at:400:659; Interrogation_Position=15992; Antisense; TTAAACGCGATGATCCGGAGTCGGA
>probe:Drosophila_2:1632637_at:456:121; Interrogation_Position=16060; Antisense; AGCGTTTGGTCCCAGTCAGATGACT
>probe:Drosophila_2:1632637_at:218:445; Interrogation_Position=16078; Antisense; GATGACTCGCGGACATATTTGTAGA

Paste this into a BLAST search page for me
GTCAACATGACCCAGCTGGCAATGGCGATATGCCTATTATGTGTGCTTTAAGATGTGTCCGAAGCATGGCACCGAGCATGGCACCGATTTCTTGGAGTACTTGGAGTACAAGTGCCGCTACTGCTTACTGCTGCTCGGTGGCGGTATTCTGGTATTCTTCTGCTTTGGAACCACATTGGAACCACACACTTCTGTGACACTATACCCAAGGTCAAGTTGCCCCAGGAATGTCCGCTGCACGTAATGCATCATGCCCAAACATTTTAGCCACACACTTAAACGCGATGATCCGGAGTCGGAAGCGTTTGGTCCCAGTCAGATGACTGATGACTCGCGGACATATTTGTAGA

Full Affymetrix probeset data:

Annotations for 1632637_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime