Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632638_at:

>probe:Drosophila_2:1632638_at:102:103; Interrogation_Position=1722; Antisense; AGAGCAACGGATTAGCCAGCAGGTC
>probe:Drosophila_2:1632638_at:555:263; Interrogation_Position=1738; Antisense; CAGCAGGTCCAGTCCGAGGTGAACG
>probe:Drosophila_2:1632638_at:255:81; Interrogation_Position=1754; Antisense; AGGTGAACGTCCTCATCAAGGGCAT
>probe:Drosophila_2:1632638_at:727:645; Interrogation_Position=1766; Antisense; TCATCAAGGGCATGGACGCCGGCAT
>probe:Drosophila_2:1632638_at:227:219; Interrogation_Position=1801; Antisense; AAGGGAGCGGCCATTATGTCCGTGC
>probe:Drosophila_2:1632638_at:223:103; Interrogation_Position=1829; Antisense; AGAGCGCCCGCGAGCTGTGGATATC
>probe:Drosophila_2:1632638_at:373:177; Interrogation_Position=1857; Antisense; AAACGACTGGCAGCGTCATGGACTG
>probe:Drosophila_2:1632638_at:149:405; Interrogation_Position=1877; Antisense; GACTGCGGGTGCTCCGCGAAAGATC
>probe:Drosophila_2:1632638_at:473:171; Interrogation_Position=1895; Antisense; AAAGATCTCCCTTCCTCTGGTGAGG
>probe:Drosophila_2:1632638_at:222:537; Interrogation_Position=1929; Antisense; GGTCGCCGCAGTGCATTTCGAATAT
>probe:Drosophila_2:1632638_at:657:349; Interrogation_Position=2009; Antisense; GCAGTATCGCAACCGTAGGCTAAAA
>probe:Drosophila_2:1632638_at:447:623; Interrogation_Position=2034; Antisense; TGCCGACCAAAGCATTACCCTGGAG
>probe:Drosophila_2:1632638_at:36:315; Interrogation_Position=2164; Antisense; GCCTGTTTTTGCATACTACTTTGTA
>probe:Drosophila_2:1632638_at:258:677; Interrogation_Position=2215; Antisense; TAGAGTCCGGCGATAAGCGCAGTAT

Paste this into a BLAST search page for me
AGAGCAACGGATTAGCCAGCAGGTCCAGCAGGTCCAGTCCGAGGTGAACGAGGTGAACGTCCTCATCAAGGGCATTCATCAAGGGCATGGACGCCGGCATAAGGGAGCGGCCATTATGTCCGTGCAGAGCGCCCGCGAGCTGTGGATATCAAACGACTGGCAGCGTCATGGACTGGACTGCGGGTGCTCCGCGAAAGATCAAAGATCTCCCTTCCTCTGGTGAGGGGTCGCCGCAGTGCATTTCGAATATGCAGTATCGCAACCGTAGGCTAAAATGCCGACCAAAGCATTACCCTGGAGGCCTGTTTTTGCATACTACTTTGTATAGAGTCCGGCGATAAGCGCAGTAT

Full Affymetrix probeset data:

Annotations for 1632638_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime