Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632639_at:

>probe:Drosophila_2:1632639_at:584:49; Interrogation_Position=311; Antisense; ATGCGCTAAAGGGTTTGCCGCTGCT
>probe:Drosophila_2:1632639_at:359:303; Interrogation_Position=375; Antisense; CCGGGATGCCAAGACCTGGTCGGAT
>probe:Drosophila_2:1632639_at:413:661; Interrogation_Position=435; Antisense; TAAACCTTCCTACCAGATATACATG
>probe:Drosophila_2:1632639_at:624:21; Interrogation_Position=451; Antisense; ATATACATGGAGATCTTCGAGACGA
>probe:Drosophila_2:1632639_at:4:425; Interrogation_Position=469; Antisense; GAGACGAAGCAGTCCTACGACGAAG
>probe:Drosophila_2:1632639_at:225:451; Interrogation_Position=495; Antisense; GATCGACTCATTCATCTGCAAGCAG
>probe:Drosophila_2:1632639_at:657:113; Interrogation_Position=515; Antisense; AGCAGCGAGCGCTCCTAGCCAAGTT
>probe:Drosophila_2:1632639_at:695:251; Interrogation_Position=534; Antisense; CAAGTTGCCGGAGGGACGACACGAC
>probe:Drosophila_2:1632639_at:246:103; Interrogation_Position=563; Antisense; AGACGGAGCTGGACTTCATCTACGG
>probe:Drosophila_2:1632639_at:607:285; Interrogation_Position=589; Antisense; CTGATGCAGCCCAAGTACCGGGAGA
>probe:Drosophila_2:1632639_at:697:419; Interrogation_Position=612; Antisense; GAGCATACCCCGACACGAGGTCAAA
>probe:Drosophila_2:1632639_at:103:161; Interrogation_Position=635; Antisense; AAACCTTCCGGGAGCTACTCGATCG
>probe:Drosophila_2:1632639_at:390:587; Interrogation_Position=671; Antisense; TGGAGCGCACAAGGCACTGAAGTTA
>probe:Drosophila_2:1632639_at:312:663; Interrogation_Position=747; Antisense; TAAATCTCTTAAGCGCCTTTATTGG

Paste this into a BLAST search page for me
ATGCGCTAAAGGGTTTGCCGCTGCTCCGGGATGCCAAGACCTGGTCGGATTAAACCTTCCTACCAGATATACATGATATACATGGAGATCTTCGAGACGAGAGACGAAGCAGTCCTACGACGAAGGATCGACTCATTCATCTGCAAGCAGAGCAGCGAGCGCTCCTAGCCAAGTTCAAGTTGCCGGAGGGACGACACGACAGACGGAGCTGGACTTCATCTACGGCTGATGCAGCCCAAGTACCGGGAGAGAGCATACCCCGACACGAGGTCAAAAAACCTTCCGGGAGCTACTCGATCGTGGAGCGCACAAGGCACTGAAGTTATAAATCTCTTAAGCGCCTTTATTGG

Full Affymetrix probeset data:

Annotations for 1632639_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime