Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632640_at:

>probe:Drosophila_2:1632640_at:577:195; Interrogation_Position=1001; Antisense; AACTGAGCGAGCGATTGGCGGCCAC
>probe:Drosophila_2:1632640_at:538:651; Interrogation_Position=1028; Antisense; TCAAGGACGCCGAGCTGGGCATTCA
>probe:Drosophila_2:1632640_at:697:401; Interrogation_Position=1060; Antisense; GACATAGCCAATCACTGGACGCAGT
>probe:Drosophila_2:1632640_at:170:659; Interrogation_Position=1143; Antisense; TAAGAGCATCCACGCGCTGAGTGAA
>probe:Drosophila_2:1632640_at:227:323; Interrogation_Position=1172; Antisense; GCGCCCTCGAGATGTGTAAGCTGCA
>probe:Drosophila_2:1632640_at:204:235; Interrogation_Position=1200; Antisense; AATCGCCGAGCTGTTGCTGGTGAAG
>probe:Drosophila_2:1632640_at:325:373; Interrogation_Position=1246; Antisense; GAAGTGGATGGCGTCGTCAATCTCT
>probe:Drosophila_2:1632640_at:601:531; Interrogation_Position=1361; Antisense; GGGTCAGCACATTCTTTTCCGAAAT
>probe:Drosophila_2:1632640_at:135:701; Interrogation_Position=1375; Antisense; TTTTCCGAAATGCTATCTGCCGTGC
>probe:Drosophila_2:1632640_at:376:643; Interrogation_Position=1390; Antisense; TCTGCCGTGCAGTTCATCGAGAAGG
>probe:Drosophila_2:1632640_at:56:369; Interrogation_Position=1410; Antisense; GAAGGCCTACAAGCTATTTACACCC
>probe:Drosophila_2:1632640_at:561:147; Interrogation_Position=1482; Antisense; ACTTTCTACTTTTACTATTGCCTGG
>probe:Drosophila_2:1632640_at:495:5; Interrogation_Position=1498; Antisense; ATTGCCTGGTTAGTGTTCTCAACTC
>probe:Drosophila_2:1632640_at:687:471; Interrogation_Position=1512; Antisense; GTTCTCAACTCACTTGTTTTTCCAT

Paste this into a BLAST search page for me
AACTGAGCGAGCGATTGGCGGCCACTCAAGGACGCCGAGCTGGGCATTCAGACATAGCCAATCACTGGACGCAGTTAAGAGCATCCACGCGCTGAGTGAAGCGCCCTCGAGATGTGTAAGCTGCAAATCGCCGAGCTGTTGCTGGTGAAGGAAGTGGATGGCGTCGTCAATCTCTGGGTCAGCACATTCTTTTCCGAAATTTTTCCGAAATGCTATCTGCCGTGCTCTGCCGTGCAGTTCATCGAGAAGGGAAGGCCTACAAGCTATTTACACCCACTTTCTACTTTTACTATTGCCTGGATTGCCTGGTTAGTGTTCTCAACTCGTTCTCAACTCACTTGTTTTTCCAT

Full Affymetrix probeset data:

Annotations for 1632640_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime