FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632641_at:

>probe:Drosophila_2:1632641_at:438:77; Interrogation_Position=1015; Antisense; AGGAGGACAAATCTGGCCGGCATCT
>probe:Drosophila_2:1632641_at:707:317; Interrogation_Position=1030; Antisense; GCCGGCATCTGGGAAGCGCTCGTAT
>probe:Drosophila_2:1632641_at:441:681; Interrogation_Position=1052; Antisense; TATGGGAGTGAAGTCTCCGCTGCGC
>probe:Drosophila_2:1632641_at:233:33; Interrogation_Position=1108; Antisense; ATCAGGACCAGGACCTTACTTCGAG
>probe:Drosophila_2:1632641_at:458:437; Interrogation_Position=1197; Antisense; GAGGAGACCTCCAGCGACTGCATGT
>probe:Drosophila_2:1632641_at:655:369; Interrogation_Position=1248; Antisense; GAATGTACATCTCTCAGCGGCGTTA
>probe:Drosophila_2:1632641_at:649:271; Interrogation_Position=1278; Antisense; CATCTGCCCACTTGGTTGGATGATT
>probe:Drosophila_2:1632641_at:101:589; Interrogation_Position=1294; Antisense; TGGATGATTGTACGGCCACCAGCAA
>probe:Drosophila_2:1632641_at:179:579; Interrogation_Position=1307; Antisense; GGCCACCAGCAAGAACGCGTTTTAA
>probe:Drosophila_2:1632641_at:667:555; Interrogation_Position=779; Antisense; GGACGAGGACACCATTGCCAAGTAC
>probe:Drosophila_2:1632641_at:45:83; Interrogation_Position=804; Antisense; AGGGACGCGTACATGCTGATCAATT
>probe:Drosophila_2:1632641_at:335:503; Interrogation_Position=905; Antisense; GTCCTCGTGGACGAAGATCCATCGT
>probe:Drosophila_2:1632641_at:198:151; Interrogation_Position=967; Antisense; ACATTGACAACCTGAATGCCCTGCG
>probe:Drosophila_2:1632641_at:618:233; Interrogation_Position=981; Antisense; AATGCCCTGCGCTTTGGTGAACTGA

Paste this into a BLAST search page for me
AGGAGGACAAATCTGGCCGGCATCTGCCGGCATCTGGGAAGCGCTCGTATTATGGGAGTGAAGTCTCCGCTGCGCATCAGGACCAGGACCTTACTTCGAGGAGGAGACCTCCAGCGACTGCATGTGAATGTACATCTCTCAGCGGCGTTACATCTGCCCACTTGGTTGGATGATTTGGATGATTGTACGGCCACCAGCAAGGCCACCAGCAAGAACGCGTTTTAAGGACGAGGACACCATTGCCAAGTACAGGGACGCGTACATGCTGATCAATTGTCCTCGTGGACGAAGATCCATCGTACATTGACAACCTGAATGCCCTGCGAATGCCCTGCGCTTTGGTGAACTGA

Full Affymetrix probeset data:

Annotations for 1632641_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720