Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632642_a_at:

>probe:Drosophila_2:1632642_a_at:134:389; Interrogation_Position=114; Antisense; GAAAAATCGCAAACGGCAGCCGCCA
>probe:Drosophila_2:1632642_a_at:224:311; Interrogation_Position=135; Antisense; GCCAGTGAAGACACCATTTTCGGCA
>probe:Drosophila_2:1632642_a_at:694:623; Interrogation_Position=166; Antisense; TGCGCAAGGAGATCCCATGCAAATT
>probe:Drosophila_2:1632642_a_at:197:605; Interrogation_Position=203; Antisense; TGATAAATGCGTTGCCTTCCACGAT
>probe:Drosophila_2:1632642_a_at:97:589; Interrogation_Position=302; Antisense; TGGAGATGCCGATCTGCTGGGACAT
>probe:Drosophila_2:1632642_a_at:663:401; Interrogation_Position=322; Antisense; GACATCTCATGCTGGTGGGCCGCAA
>probe:Drosophila_2:1632642_a_at:281:441; Interrogation_Position=372; Antisense; GATGGCTACCGCGTGGTCATCAACA
>probe:Drosophila_2:1632642_a_at:84:497; Interrogation_Position=416; Antisense; GTCAGTTTACCACTTGCATTTGCAC
>probe:Drosophila_2:1632642_a_at:114:99; Interrogation_Position=457; Antisense; AGATGCAGTGGCCACCAGGATAAGA
>probe:Drosophila_2:1632642_a_at:435:109; Interrogation_Position=479; Antisense; AGAAGCAGCCGATGGTGCAGCTACC
>probe:Drosophila_2:1632642_a_at:90:535; Interrogation_Position=492; Antisense; GGTGCAGCTACCAGATCCAAGATCA
>probe:Drosophila_2:1632642_a_at:42:475; Interrogation_Position=567; Antisense; GTTACTTTAAATTCGCCATGTCCAT
>probe:Drosophila_2:1632642_a_at:649:485; Interrogation_Position=622; Antisense; GTAGTGCTACTTCATTTTTCCATAA
>probe:Drosophila_2:1632642_a_at:217:339; Interrogation_Position=67; Antisense; GCTCTCGCCAAATAGCAAGCTGCAG

Paste this into a BLAST search page for me
GAAAAATCGCAAACGGCAGCCGCCAGCCAGTGAAGACACCATTTTCGGCATGCGCAAGGAGATCCCATGCAAATTTGATAAATGCGTTGCCTTCCACGATTGGAGATGCCGATCTGCTGGGACATGACATCTCATGCTGGTGGGCCGCAAGATGGCTACCGCGTGGTCATCAACAGTCAGTTTACCACTTGCATTTGCACAGATGCAGTGGCCACCAGGATAAGAAGAAGCAGCCGATGGTGCAGCTACCGGTGCAGCTACCAGATCCAAGATCAGTTACTTTAAATTCGCCATGTCCATGTAGTGCTACTTCATTTTTCCATAAGCTCTCGCCAAATAGCAAGCTGCAG

Full Affymetrix probeset data:

Annotations for 1632642_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime