FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632643_at:

>probe:Drosophila_2:1632643_at:48:209; Interrogation_Position=1128; Antisense; AAGCAACGCCGTACGATTTTATCCT
>probe:Drosophila_2:1632643_at:413:13; Interrogation_Position=1143; Antisense; ATTTTATCCTCAGCGAAGCGACGGC
>probe:Drosophila_2:1632643_at:112:131; Interrogation_Position=1214; Antisense; ACGCCGGCCACCAGTGAGGAAATAA
>probe:Drosophila_2:1632643_at:208:653; Interrogation_Position=1257; Antisense; TAAATCCCGTCGTAGAGGAGTCCTC
>probe:Drosophila_2:1632643_at:328:633; Interrogation_Position=1319; Antisense; TCCGACAAACTGTTGACCACCGTGA
>probe:Drosophila_2:1632643_at:152:723; Interrogation_Position=1331; Antisense; TTGACCACCGTGATTGCCAACATGG
>probe:Drosophila_2:1632643_at:616:189; Interrogation_Position=1349; Antisense; AACATGGAGACCGTGCTTCAGCAAT
>probe:Drosophila_2:1632643_at:478:67; Interrogation_Position=1386; Antisense; AGGCCCAGATTCACCACGAACAGGA
>probe:Drosophila_2:1632643_at:184:189; Interrogation_Position=1422; Antisense; AACAGCGAAGTACACAGCCTGCCAA
>probe:Drosophila_2:1632643_at:589:69; Interrogation_Position=1461; Antisense; AGGCTCAGATGCTGCTGGACGGACT
>probe:Drosophila_2:1632643_at:14:143; Interrogation_Position=1483; Antisense; ACTGAGTCCGTCTGAGCGGGCAAGT
>probe:Drosophila_2:1632643_at:609:417; Interrogation_Position=1511; Antisense; GAGCGTAAGATCGTGCAGTTCCTGT
>probe:Drosophila_2:1632643_at:167:267; Interrogation_Position=1538; Antisense; CAGTGCCAAATCAAAGCCCTCGATG
>probe:Drosophila_2:1632643_at:701:441; Interrogation_Position=1577; Antisense; GATGTGGCACCTTGTCAGGTCATTA

Paste this into a BLAST search page for me
AAGCAACGCCGTACGATTTTATCCTATTTTATCCTCAGCGAAGCGACGGCACGCCGGCCACCAGTGAGGAAATAATAAATCCCGTCGTAGAGGAGTCCTCTCCGACAAACTGTTGACCACCGTGATTGACCACCGTGATTGCCAACATGGAACATGGAGACCGTGCTTCAGCAATAGGCCCAGATTCACCACGAACAGGAAACAGCGAAGTACACAGCCTGCCAAAGGCTCAGATGCTGCTGGACGGACTACTGAGTCCGTCTGAGCGGGCAAGTGAGCGTAAGATCGTGCAGTTCCTGTCAGTGCCAAATCAAAGCCCTCGATGGATGTGGCACCTTGTCAGGTCATTA

Full Affymetrix probeset data:

Annotations for 1632643_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720