Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632645_at:

>probe:Drosophila_2:1632645_at:287:463; Interrogation_Position=1555; Antisense; GATTCCCTCCTACAATTCCAAGAGA
>probe:Drosophila_2:1632645_at:709:451; Interrogation_Position=1578; Antisense; GATCTAGTTCGCAGTAGTTCGGGAA
>probe:Drosophila_2:1632645_at:166:565; Interrogation_Position=1611; Antisense; GGCAATGTCCATGTCACAGTGACCA
>probe:Drosophila_2:1632645_at:227:195; Interrogation_Position=1653; Antisense; AACTGCAGCATGAGGCGTTCATCCA
>probe:Drosophila_2:1632645_at:493:473; Interrogation_Position=1669; Antisense; GTTCATCCAATGACCGGGCTAGTGA
>probe:Drosophila_2:1632645_at:527:227; Interrogation_Position=1707; Antisense; AATGGAAACCAAACCTGCGTCGCCT
>probe:Drosophila_2:1632645_at:428:283; Interrogation_Position=1721; Antisense; CTGCGTCGCCTGTCTGAATAATATG
>probe:Drosophila_2:1632645_at:512:455; Interrogation_Position=1754; Antisense; GATAACCACATCTCGGTCCAGGGAT
>probe:Drosophila_2:1632645_at:569:455; Interrogation_Position=1776; Antisense; GATACGGATCTAGCCTTCAGTCTGA
>probe:Drosophila_2:1632645_at:282:387; Interrogation_Position=1857; Antisense; GAAAGCCAAGATTCCTGTCAGGTTA
>probe:Drosophila_2:1632645_at:344:497; Interrogation_Position=1873; Antisense; GTCAGGTTAACATCAGCGTGTATGC
>probe:Drosophila_2:1632645_at:638:329; Interrogation_Position=1888; Antisense; GCGTGTATGCGGATAAACTGCGTTT
>probe:Drosophila_2:1632645_at:726:333; Interrogation_Position=1997; Antisense; GCTGTTCCAGAAGACGCTCATATAC
>probe:Drosophila_2:1632645_at:190:647; Interrogation_Position=2014; Antisense; TCATATACTCCCCTAACTTTTCTAT

Paste this into a BLAST search page for me
GATTCCCTCCTACAATTCCAAGAGAGATCTAGTTCGCAGTAGTTCGGGAAGGCAATGTCCATGTCACAGTGACCAAACTGCAGCATGAGGCGTTCATCCAGTTCATCCAATGACCGGGCTAGTGAAATGGAAACCAAACCTGCGTCGCCTCTGCGTCGCCTGTCTGAATAATATGGATAACCACATCTCGGTCCAGGGATGATACGGATCTAGCCTTCAGTCTGAGAAAGCCAAGATTCCTGTCAGGTTAGTCAGGTTAACATCAGCGTGTATGCGCGTGTATGCGGATAAACTGCGTTTGCTGTTCCAGAAGACGCTCATATACTCATATACTCCCCTAACTTTTCTAT

Full Affymetrix probeset data:

Annotations for 1632645_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime