FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632646_at:

>probe:Drosophila_2:1632646_at:709:227; Interrogation_Position=102; Antisense; AATGGCGCTGCTTAGCCTGACAAAT
>probe:Drosophila_2:1632646_at:726:225; Interrogation_Position=128; Antisense; AAGGAATCGCCAGTCAGTACGCCAG
>probe:Drosophila_2:1632646_at:121:185; Interrogation_Position=235; Antisense; AAAATGCTCAGTGCCCTATTCGGAT
>probe:Drosophila_2:1632646_at:11:101; Interrogation_Position=285; Antisense; AGAGATGGCGATGGTCATGCCCCAT
>probe:Drosophila_2:1632646_at:64:321; Interrogation_Position=315; Antisense; GCCGCCCATGTACTATAACGATTTC
>probe:Drosophila_2:1632646_at:232:713; Interrogation_Position=337; Antisense; TTCTATGAGGATCTGGTGACCACCA
>probe:Drosophila_2:1632646_at:672:199; Interrogation_Position=362; Antisense; AACGCAATGATGTCCATTCCGCAGG
>probe:Drosophila_2:1632646_at:464:341; Interrogation_Position=443; Antisense; GCTTTCTGATGAATGCCGTTTGCGA
>probe:Drosophila_2:1632646_at:599:451; Interrogation_Position=484; Antisense; GATCTGGCCAAGTGCTCGCATGGAT
>probe:Drosophila_2:1632646_at:550:347; Interrogation_Position=501; Antisense; GCATGGATCCAATTGCAGGCCACTG
>probe:Drosophila_2:1632646_at:403:453; Interrogation_Position=565; Antisense; GATCACCCCTATTCGTGGATGAACA
>probe:Drosophila_2:1632646_at:426:721; Interrogation_Position=600; Antisense; TTGGCAGTTCAAAACGGTCACCGTA
>probe:Drosophila_2:1632646_at:141:627; Interrogation_Position=627; Antisense; TGCCGGCTGCTTCTGCACAAAGTGA
>probe:Drosophila_2:1632646_at:582:97; Interrogation_Position=65; Antisense; AGATCGAGCATGATGCCTTGCCCAT

Paste this into a BLAST search page for me
AATGGCGCTGCTTAGCCTGACAAATAAGGAATCGCCAGTCAGTACGCCAGAAAATGCTCAGTGCCCTATTCGGATAGAGATGGCGATGGTCATGCCCCATGCCGCCCATGTACTATAACGATTTCTTCTATGAGGATCTGGTGACCACCAAACGCAATGATGTCCATTCCGCAGGGCTTTCTGATGAATGCCGTTTGCGAGATCTGGCCAAGTGCTCGCATGGATGCATGGATCCAATTGCAGGCCACTGGATCACCCCTATTCGTGGATGAACATTGGCAGTTCAAAACGGTCACCGTATGCCGGCTGCTTCTGCACAAAGTGAAGATCGAGCATGATGCCTTGCCCAT

Full Affymetrix probeset data:

Annotations for 1632646_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720