FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632649_at:

>probe:Drosophila_2:1632649_at:347:725; Interrogation_Position=1398; Antisense; TTGGGCTATCCCATTTCAAATGATC
>probe:Drosophila_2:1632649_at:10:203; Interrogation_Position=1431; Antisense; AACCATGAAGTTTTCGGTCCATTGA
>probe:Drosophila_2:1632649_at:710:103; Interrogation_Position=1580; Antisense; AGACGTAGCAGCAAGTACTTCAGTA
>probe:Drosophila_2:1632649_at:306:677; Interrogation_Position=1606; Antisense; TAGAGGCTCCCTCAGTAGTTCAGGC
>probe:Drosophila_2:1632649_at:62:199; Interrogation_Position=1686; Antisense; AACGATGCTACTGCACAGATTGCCA
>probe:Drosophila_2:1632649_at:444:9; Interrogation_Position=1704; Antisense; ATTGCCACCCAAACGTGCTATGAGG
>probe:Drosophila_2:1632649_at:219:265; Interrogation_Position=1732; Antisense; CAGACAGGTCCTTTGATTCCAAGAA
>probe:Drosophila_2:1632649_at:357:147; Interrogation_Position=1761; Antisense; ACTTCGGATCCGCAATGTTCTGAAT
>probe:Drosophila_2:1632649_at:153:95; Interrogation_Position=1789; Antisense; AGATAAACTACAGAGACCCCGGCAC
>probe:Drosophila_2:1632649_at:582:411; Interrogation_Position=1803; Antisense; GACCCCGGCACAAAGGATCTCATAA
>probe:Drosophila_2:1632649_at:565:545; Interrogation_Position=1817; Antisense; GGATCTCATAATGTACTTGCATGCA
>probe:Drosophila_2:1632649_at:233:431; Interrogation_Position=1862; Antisense; TTGGGAGTACGAAACCGAATTGCCG
>probe:Drosophila_2:1632649_at:460:361; Interrogation_Position=1878; Antisense; GAATTGCCGGAATGGGCGTGTAATT
>probe:Drosophila_2:1632649_at:198:7; Interrogation_Position=1936; Antisense; ATTGATTGCAAACACGACGCTTTAG

Paste this into a BLAST search page for me
TTGGGCTATCCCATTTCAAATGATCAACCATGAAGTTTTCGGTCCATTGAAGACGTAGCAGCAAGTACTTCAGTATAGAGGCTCCCTCAGTAGTTCAGGCAACGATGCTACTGCACAGATTGCCAATTGCCACCCAAACGTGCTATGAGGCAGACAGGTCCTTTGATTCCAAGAAACTTCGGATCCGCAATGTTCTGAATAGATAAACTACAGAGACCCCGGCACGACCCCGGCACAAAGGATCTCATAAGGATCTCATAATGTACTTGCATGCATTGGGAGTACGAAACCGAATTGCCGGAATTGCCGGAATGGGCGTGTAATTATTGATTGCAAACACGACGCTTTAG

Full Affymetrix probeset data:

Annotations for 1632649_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720