FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632650_at:

>probe:Drosophila_2:1632650_at:668:585; Interrogation_Position=489; Antisense; TGGACAAGGTCAACTTCCGGCTGAA
>probe:Drosophila_2:1632650_at:44:411; Interrogation_Position=519; Antisense; GACGCGTGCGCATGGAGATCCTTTC
>probe:Drosophila_2:1632650_at:710:97; Interrogation_Position=534; Antisense; AGATCCTTTCGCATGTGCCACAAAT
>probe:Drosophila_2:1632650_at:228:221; Interrogation_Position=617; Antisense; AAGGGCGCCTTCAACATTACCATGA
>probe:Drosophila_2:1632650_at:43:119; Interrogation_Position=675; Antisense; AGCTCTACGAGCGTGATGGTCACAC
>probe:Drosophila_2:1632650_at:435:683; Interrogation_Position=701; Antisense; TATCTGCGCCTGACCAAACTGGAGA
>probe:Drosophila_2:1632650_at:386:531; Interrogation_Position=739; Antisense; GGGTGACCTGAAATTCTACGCCAAT
>probe:Drosophila_2:1632650_at:356:671; Interrogation_Position=755; Antisense; TACGCCAATGGACTAGTTCCCGATC
>probe:Drosophila_2:1632650_at:522:449; Interrogation_Position=776; Antisense; GATCCGGTGCTGAACGATGTCATCT
>probe:Drosophila_2:1632650_at:296:685; Interrogation_Position=808; Antisense; TATCAATCAGTACTGGCGCCAGCTT
>probe:Drosophila_2:1632650_at:723:423; Interrogation_Position=851; Antisense; GAGACATTGGACACCTGGCAGCCGC
>probe:Drosophila_2:1632650_at:458:231; Interrogation_Position=893; Antisense; AATGACTTCTTTGCTGCACTACCGT
>probe:Drosophila_2:1632650_at:27:669; Interrogation_Position=912; Antisense; TACCGTTCGATATGCTTGTTACCAA
>probe:Drosophila_2:1632650_at:623:541; Interrogation_Position=984; Antisense; GGATTCATCTGTTCTACTCAAGGTG

Paste this into a BLAST search page for me
TGGACAAGGTCAACTTCCGGCTGAAGACGCGTGCGCATGGAGATCCTTTCAGATCCTTTCGCATGTGCCACAAATAAGGGCGCCTTCAACATTACCATGAAGCTCTACGAGCGTGATGGTCACACTATCTGCGCCTGACCAAACTGGAGAGGGTGACCTGAAATTCTACGCCAATTACGCCAATGGACTAGTTCCCGATCGATCCGGTGCTGAACGATGTCATCTTATCAATCAGTACTGGCGCCAGCTTGAGACATTGGACACCTGGCAGCCGCAATGACTTCTTTGCTGCACTACCGTTACCGTTCGATATGCTTGTTACCAAGGATTCATCTGTTCTACTCAAGGTG

Full Affymetrix probeset data:

Annotations for 1632650_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720