Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632652_s_at:

>probe:Drosophila_2:1632652_s_at:422:215; Interrogation_Position=115; Antisense; AAGATCTTCACACTCCCGGAAAACT
>probe:Drosophila_2:1632652_s_at:245:21; Interrogation_Position=145; Antisense; ATATATCCGGCGCACGACTATAAAG
>probe:Drosophila_2:1632652_s_at:272:9; Interrogation_Position=147; Antisense; ATATCCGGCGCACGACTATAAAGGT
>probe:Drosophila_2:1632652_s_at:129:289; Interrogation_Position=152; Antisense; CGGCGCACGACTATAAAGGTCAAAT
>probe:Drosophila_2:1632652_s_at:564:221; Interrogation_Position=167; Antisense; AAGGTCAAATGGAAAGCAGTGTGTG
>probe:Drosophila_2:1632652_s_at:195:75; Interrogation_Position=194; Antisense; AGGAGAAGCGGTATAACCCCAGACT
>probe:Drosophila_2:1632652_s_at:60:379; Interrogation_Position=198; Antisense; GAAGCGGTATAACCCCAGACTGACT
>probe:Drosophila_2:1632652_s_at:540:329; Interrogation_Position=201; Antisense; GCGGTATAACCCCAGACTGACTAAG
>probe:Drosophila_2:1632652_s_at:528:483; Interrogation_Position=204; Antisense; GTATAACCCCAGACTGACTAAGGAT
>probe:Drosophila_2:1632652_s_at:59:201; Interrogation_Position=208; Antisense; AACCCCAGACTGACTAAGGATATTG
>probe:Drosophila_2:1632652_s_at:719:299; Interrogation_Position=211; Antisense; CCCAGACTGACTAAGGATATTGAAG
>probe:Drosophila_2:1632652_s_at:549:373; Interrogation_Position=232; Antisense; GAAGAGTTTGTCAAAATCATGGAAA
>probe:Drosophila_2:1632652_s_at:540:625; Interrogation_Position=82; Antisense; TGCCCACGTAATCTCTACGAGAATG
>probe:Drosophila_2:1632652_s_at:630:257; Interrogation_Position=86; Antisense; CACGTAATCTCTACGAGAATGTGCA

Paste this into a BLAST search page for me
AAGATCTTCACACTCCCGGAAAACTATATATCCGGCGCACGACTATAAAGATATCCGGCGCACGACTATAAAGGTCGGCGCACGACTATAAAGGTCAAATAAGGTCAAATGGAAAGCAGTGTGTGAGGAGAAGCGGTATAACCCCAGACTGAAGCGGTATAACCCCAGACTGACTGCGGTATAACCCCAGACTGACTAAGGTATAACCCCAGACTGACTAAGGATAACCCCAGACTGACTAAGGATATTGCCCAGACTGACTAAGGATATTGAAGGAAGAGTTTGTCAAAATCATGGAAATGCCCACGTAATCTCTACGAGAATGCACGTAATCTCTACGAGAATGTGCA

Full Affymetrix probeset data:

Annotations for 1632652_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime